Database reference: HIV2ID0005

Virus: HIV-2

Type of target: Probe

Techniques: PCR

Target: Probe

Status: Published

Original name: SR76

Target length: 25

Amplicon length:

Sequence (5'-3'): TAATACTGTCTGCGTCATTTGGTGC

Position in reference genome: 782-806

Genomic region: gag

Related image:

Related publications:
Heredia, Alonso, et al. "Enhanced diagnostic efficiency of the polymerase chain reaction by co-amplification of multiple regions of HIV-1 and HIV-2." Journal of virological methods 49.1 (1994): 37-46.