Complete list of oligonucleotides

The table describes all information for each oligonucleotide retrieved from peer-reviewed publications.

Click on the oligonucleotide reference number to open a separate page with additional information.


Database reference Type of target Techniques Target Original name Target length Amplicon length Sequence (5'-3') Position in reference genome Genomic region Sequence in reference genome Related publications
Database reference Type of target Techniques Target Original name Target length Amplicon length Sequence (5'-3') Position in reference genome Genomic region Sequence in reference genome Related publications
HIV1ID0001 PCR primer pair Nested PCR PCR primer forward A1352 23 95 GRAACCCACTGCTTAASSCTCAA 506-528 5'LTR GGAACCCACUGCUUAAGCCUCAA 1
HIV1ID0002 PCR primer pair Nested PCR PCR primer reverse A1355 23 GAGGGATCTCTAGNYACCAGAGT 578-600 5'LTR ACUCUGGUAACUAGAGAUCCCUC 1
HIV1ID0003 PCR primer pair Nested PCR PCR primer forward A1354 21 125 CTCAATAAAGCTTGCCTTGAG 524-544 5'LTR CUCAAUAAAGCUUGCCUUGAG 1
HIV1ID0004 PCR primer pair Nested PCR PCR primer reverse A1353 23 TGTTCGGGCGCCACTGCTAGAGA 626-648 5'LTR UCUCUAGCAGUGGCGCCCGAACA 1
HIV1ID0005 PCR primer pair SYBR Green real time PCR PCR primer reverse SK431 27 142 TGCTATGTCAGTTCCCCTTGGTTCTCT 1474-1500 gag AGAGAACCAAGGGGAAGUGACAUAGCA 2; 3; 4; 5; 6; 7;
HIV1ID0006 PCR primer pair SYBR Green real time PCR PCR primer forward SK462 30 AGTTGGAGGACATCAAGCAGCCATGCAAAT 1359-1388 gag AGUGGGGGGACAUCAAGCAGCCAUGCAAAU 2; 3; 4; 5; 6; 7;
HIV1ID0007 Probe PCR Probe SK102 33 GAGACCATCAATGAGGAAGCTGCAGAATGG(...) 1396-1428 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 2; 3; 7;
HIV1ID0008 Probe PCR Probe CO3 40 TGAGTTGCAACAGATGCTGTTGCGCCTCAA(...) 7890-7929 env CUGAGGGCUAUUGAGGCGCAACAGCAUCUG(...) 8
HIV1ID0009 PCR primer pair Multiplex-RT PCR & ELISA PCR primer forward F2 23 189 CAGAAGGAGCCACCCCACAAGAT 1316-1338 gag CAGAAGGAGCCACCCCACAAGAU 9
HIV1ID0010 PCR primer pair Multiplex-RT PCR & ELISA PCR primer reverse R2 25 TTCCTGCTATGTCACTTCCCCTTGG 1480-1504 gag CCAAGGGGAAGUGACAUAGCAGGAA 10
HIV1ID0011 Probe Multiplex-RT PCR & ELISA Probe ziv 22 CTTGGTTCTCTCATYTGGCCTG 1463-1484 gag CAGGCCAGAUGAGAGAACCAAG 11
HIV1ID0012 PCR primer pair Multiplex real-time PCR & mole(...) PCR primer forward 18 151 GTACAGTGCAGGGGAAAG 4808-4825 pol GUACAGUGCAGGGGAAAG 12
HIV1ID0013 PCR primer pair Multiplex real-time PCR & mole(...) PCR primer reverse 20 CCAGAGTAGTTTTGCTGGTC 4939-4958 pol GACCAGCAAAGCUCCUCUGG 12
HIV1ID0014 Probe Multiplex real-time PCR & mole(...) Probe (molecular beacons) 32 CCCGTGGTTTATTACAGGGACAGCAGAACG(...) 4901-4923 pol GGUUUAUUACAGGGACAGCAGAA 12
HIV1ID0015 PCR primer pair Multiplex-RT PCR & ELISA PCR primer forward SK100 19 291 ATCAAGCAGCCATGCAAAT 1370-1388 gag AUCAAGCAGCCAUGCAAAU 13
HIV1ID0016 PCR primer pair Multiplex-RT PCR & ELISA PCR primer reverse SK104 22 CTTTTGGTCCTTGTCTTATGTC 1639-1660 gag GACAUAAGACAAGGACCAAAGG 13
HIV1ID0017 Probe Multiplex-RT PCR & ELISA Probe H-1 probe 23 AATGAGGAGGCTGCAGAATGGGA 1405-1427 gag AAUGAGGAAGCUGCAGAAUGGGA 13
HIV1ID0018 PCR primer pair Multiplex real-time PCR & mole(...) PCR primer forward SK 38, gagF 28 115 ATAATCCACCTATCCCAGTAGGAGAAAT 1544-1571 gag AUAAUCCACCUAUCCCAGUAGGAGAAAU 14; 15; 19; 8;
HIV1ID0019 PCR primer pair Multiplex real-time PCR & mole(...) PCR primer reverse gagR 27 TTTGGTCCTTGTCTTATGTCCAGAATG 1632-1658 gag CAUUCUGGACAUAAGACAAGGACCAAA 14; 19;
HIV1ID0020 Probe Multiplex real-time PCR & mole(...) Probe (molecular beacons) 45 GCGAGCCTGGGATTAAATAAAATAGTAAGA(...) 1591-1623 gag CUGGGAUUAAAUAAAAUAGUAAGAAUGUAU(...) 14
HIV1ID0021 PCR primer pair Multiplex real-time PCR & Taqm(...) PCR primer forward LTR-F 20 76 TAAAGCTTGCCTTGAGTGCT 529-548 5'LTR UAAAGCUUGCCUUGAGUGCU 16
HIV1ID0022 PCR primer pair Multiplex real-time PCR & Taqm(...) PCR primer reverse LTR-R2 24 GTCTGAGGGATCTCTAGTTACCAG 581-604 5'LTR CUGGUAACUAGAGAUCCCUCAGAC 16
HIV1ID0023 Probe Multiplex real-time PCR & Taqm(...) Probe (Taqman) LTR-P 26 AGTAGTGTGTGCCCGTCTGTTGTGTG 552-577 5'LTR AGUAGUGUGUGCCCGUCUGUUGUGUG 16
HIV1ID0024 PCR primer pair Nested PCR PCR primer forward WOI1 25 333 GAGAGATGGGTGCGAGAGCGTCAGT 785-809 gag GAGAGAUGGGUGCGAGAGCGUCAGU 17
HIV1ID0025 PCR primer pair Nested PCR PCR primer reverse WOI2 25 TGTTTTGCTCTTCCTCTATCTTGTC 1093-1117 gag GACAAGAUAGAGGAAGAGCAAAACA 17
HIV1ID0026 PCR primer pair Nested PCR PCR primer forward WII1-2 18 TGCGAGAGCGTCAGTATT 795-812 gag UGCGAGAGCGUCAGUAUU 17
HIV1ID0027 PCR primer pair Nested PCR PCR primer reverse WII2 19 AGGGTTGCTACTGTATTAT 1025-1043 gag AUAAUACAGUAGCAACCCU 17
HIV1ID0028 PCR primer pair multiplex real-time PCR & olig(...) PCR primer reverse HIV_OUT_F 26 284 AGAACCGRTCTACATARTCTCTAARG 1665-1690 gag CUUUAGAGACUAUGUAGACCGGUUCU 18
HIV1ID0029 PCR primer pair multiplex real-time PCR & olig(...) PCR primer forward HIV_OUT_R 21 TGAGGARGCTGCAGAATGGGA 1407-1427 gag UGAGGAAGCUGCAGAAUGGGA 18
HIV1ID0030 PCR primer pair multiplex real-time PCR & olig(...) PCR primer reverse HIV_IN_F_I 25 181 TGGYCCTTGTYTTATGTCCARAATG 1632-1665 gag CAUUCUGGACAUAAGACAAGGACCAAAGGA(...) 18
HIV1ID0031 PCR primer pair multiplex real-time PCR & olig(...) PCR primer forward HIV_IN_R 23 AGAACCAAGGGGAAGTGACATAG 1476-1498 gag AGAACCAAGGGGAAGUGACAUAG 18
HIV1ID0032 PCR primer pair SYBR Green real time PCR PCR primer forward NP51 26 228 GCAGCATAGAACAAAAATAGAGGAGC 3137-3162 pol GCAGCAUAGAACAAAAAUAGAGGAGC 19
HIV1ID0033 PCR primer pair SYBR Green real time PCR PCR primer reverse NP52 24 GGGTAAATCTGACTTGCCCAATTC 3341-3364 pol GAAUUGGGCAAGUCAGAUUUACCC 19
HIV1ID0034 PCR primer pair SYBR Green real time PCR PCR primer forward NP170 26 132 GARACCAARAATGATAGGRGGAATTG 2378-2403 pol GAAACCAAAAAUGAUAGGGGGAAUUG 19
HIV1ID0035 PCR primer pair SYBR Green real time PCR PCR primer reverse NP171 23 CCAATTATGTTGACAGGKGTRGG 2487-2509 pol CCUACACCUGUCAACAUAAUUGG 19
HIV1ID0036 PCR primer pair SYBR Green real time PCR PCR primer forward NP175 25 159 GRGAAAGAATARTAGACATAATAGC 4819-4843 pol GGGAAAGAAUAGUAGACAUAAUAGC 19
HIV1ID0037 PCR primer pair SYBR Green real time PCR PCR primer reverse NP174 21 CTACYGCCCCTTYACCTTTCC 4957-4977 pol GGAAAGGUGAAGGGGCAGUAG 19
HIV1ID0038 PCR primer pair PCR PCR primer forward SK 29 18 105 ACTAGGGAACCCACTGCT 501-518 5'LTR ACUAGGGAACCCACUGCU 8
HIV1ID0039 PCR primer pair PCR PCR primer reverse SK 30 17 GGTCTGAGGGATCTCTA 589-605 5'LTR UAGAGAUCCCUCAGACC 8
HIV1ID0040 Probe PCR Probe SK 31 34 ACCAGAGTCACACAACAGACGGGCACACAC(...) 552-585 5'LTR AGUAGUGUGUGCCCGUCUGUUGUGUGACUC(...) 8
HIV1ID0041 PCR primer pair PCR PCR primer forward SK 68 20 142 AGCAGCAGGAAGCACTATGG 7796-7815 env AGCAGCAGGAAGCACUAUGG 8
HIV1ID0042 PCR primer pair PCR PCR primer reverse SK 69 21 CCAGACTGTGAGTTGCAACAG 7917-7937 env CUGUUGCAACUCACAGUCUGG 8
HIV1ID0043 Probe PCR Probe SK 70 35 ACGGTACAGGCCAGACAATTATTGTCTGGT(...) 7836-7870 env ACGGUACAGGCCAGACAAUUAUUGUCUGGU(...) 8
HIV1ID0044 PCR primer pair PCR PCR primer forward CO1 20 135 ACAATTATTGTCTGGTATAG 7850-7869 env ACAAUUAUUGUCUGGUAUAG 8
HIV1ID0045 PCR primer pair PCR PCR primer reverse CO2 20 AGGTATCTTTCCACAGCCAG 7965-7984 env CUGGCUGUGGAAAGAUACCU 8
HIV1ID0046 Primer Recombinase Polymerase Amplifi(...) Primer forward gag F1 32 TCACCTAGAACTTTAAATGCATGGGTAAAA(...) 1231-1262 gag UCACCUAGAACUUUAAAUGCAUGGGUAAAA(...) 20
HIV1ID0047 Primer Recombinase Polymerase Amplifi(...) Primer forward gag F2 32 AATGCATGGGTAAAAGTAGTAGAAGAGAAG(...) 1246-1277 gag AAUGCAUGGGUAAAAGUAGUAGAAGAGAAG(...) 20
HIV1ID0048 Primer Recombinase Polymerase Amplifi(...) Primer forward gag F3 32 AAGGCTTTCAGCCCAGAAGTGATACCCATG(...) 1273-1304 gag AAGGCUUUCAGCCCAGAAGUGAUACCCAUG(...) 20
HIV1ID0049 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R1 32 TATTTGTTCCTGAAGGGTACTAGTAGTTCC(...) 1499-1530 gag CAGGAACUACUAGUACCCUUCAGGAACAAA(...) 20
HIV1ID0050 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R2 32 TACTAGTAGTTCCTGCTATGTCACTTCCCC(...) 1482-1513 gag AAGGGGAAGUGACAUAGCAGGAACUACUAG(...) 20
HIV1ID0051 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R3 32 CCTGCTATGTCACTTCCCCTTGGTTCTCTC(...) 1471-1502 gag AUGAGAGAACCAAGGGGAAGUGACAUAGCA(...) 20
HIV1ID0052 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R4 32 TTGATGGTCTCTTTTAACATTTGCATGGCT(...) 1375-1406 gag GCAGCCAUGCAAAUGUUAAAAGAGACCAUC(...) 20
HIV1ID0053 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R44 32 CCCATTCTGCAGCTTCCTCATTGATGGTCT(...) 1396-1426 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 20
HIV1ID0054 Primer Recombinase Polymerase Amplifi(...) Primer reverse gag R45 32 TCATTGATGGTCTCTTTTAACATTTGCATG(...) 1378-1409 gag GCCAUGCAAAUGUUAAAAGAGACCAUCAAU(...) 20
HIV1ID0055 Primer Recombinase Polymerase Amplifi(...) Primer forward LTR F2 33 CATATAAGCAGCTGCTTTTTGCCTGTACTG(...) 425-457 LTR CAUAUAAGCAGCUGCUUUUUGCCUGUACUG(...) 20
HIV1ID0056 Primer Recombinase Polymerase Amplifi(...) Primer forward LTR F3 31 CCTGTACTGGGTCTCTCTGGTTAGACCAGA(...) 446-476 LTR CCUGUACUGGGUCUCUCUGGUUAGACCAGA(...) 20
HIV1ID0057 Primer Recombinase Polymerase Amplifi(...) Primer forward LTR F4 34 CTGGGTCTCTCTGGTTAGACCAGATTTGAG(...) 452-485 LTR CUGGGUCUCUCUGGUUAGACCAGAUCUGAG(...) 20
HIV1ID0058 Primer Recombinase Polymerase Amplifi(...) Primer forward LTR F5 33 TTAGACCAGATTTGAGCCTGGGAGCTCTCT(...) 466-498 LTR UUAGACCAGAUCUGAGCCUGGGAGCUCUCU(...) 20
HIV1ID0059 Primer Recombinase Polymerase Amplifi(...) Primer forward LTR F6 32 CCTGGGAGCTCTCTGGCTAACTAGGGAACC(...) 482-513 LTR CCUGGGAGCUCUCUGGCUAACUAGGGAACC(...) 20
HIV1ID0060 Primer Recombinase Polymerase Amplifi(...) Primer reverse LTR R1 30 CCCTGTTCGGGCGCCACTGCTAGAGATTTT 622-651 LTR AAAAUCUCUAGCAGUGGCGCCCGAACAGGG 20
HIV1ID0061 Primer Recombinase Polymerase Amplifi(...) Primer reverse LTR R2 33 TCTGAGGGATCTCTAGTTACCAGAGTCACA(...) 571-603 LTR UUGUGUGACUCUGGUAACUAGAGAUCCCUC(...) 20
HIV1ID0062 Primer Recombinase Polymerase Amplifi(...) Primer reverse LTR R3 32 ATCTCTAGTTACCAGAGTCACACAACAGAC(...) 564-595 LTR CCGUCUGUUGUGUGACUCUGGUAACUAGAG(...) 20
HIV1ID0063 Primer Recombinase Polymerase Amplifi(...) Primer reverse LTR R4 32 CCAGAGTCACACAACAGACGGGCACACACT(...) 553-584 LTR GUAGUGUGUGCCCGUCUGUUGUGUGACUCU(...) 20
HIV1ID0064 Primer Recombinase Polymerase Amplifi(...) Primer forward pol F1 33 CCCTACAATCCCCAAAGTCAAGGAGTAGTA(...) 4653-4685 pol CCCUACAAUCCCCAAAGUCAAGGAGUAGUA(...) 20
HIV1ID0065 Primer Recombinase Polymerase Amplifi(...) Primer forward pol F2 33 CCCAAAGTCAAGGAGTAGTAGAATCTATGA(...) 4663-4695 pol CCCAAAGUCAAGGAGUAGUAGAAUCUAUGA(...) 20
HIV1ID0066 Primer Recombinase Polymerase Amplifi(...) Primer forward pol F3 34 TAGTAGAATCTATGAATAAAGAATTAAAGA(...) 4678-4711 pol UAGUAGAAUCUAUGAAUAAAGAAUUAAAGA(...) 20
HIV1ID0067 Primer Recombinase Polymerase Amplifi(...) Primer forward pol F4 33 ACAGCAGTACAAATGGCAGTATTCATCCAC(...) 4749-4781 pol ACAGCAGUACAAAUGGCAGUAUUCAUCCAC(...) 20
HIV1ID0068 Primer Recombinase Polymerase Amplifi(...) Primer forward pol F5 34 TGGCAGTATTCATTCACAATTTTAAAAGAA(...) 4762-4795 pol UGGCAGUAUUCAUCCACAAUUUUAAAAGAA(...) 20
HIV1ID0069 Primer Recombinase Polymerase Amplifi(...) Primer reverse pol R1 32 TGTATTACTACTGCCCCTTCACCTTTCCAG(...) 4953-4984 pol CUCUGGAAAGGUGAAGGGGCAGUAGUAAUA(...) 20
HIV1ID0070 Primer Recombinase Polymerase Amplifi(...) Primer reverse pol R2 31 CTGTAATAAACCCGAAAATTTTGAATTTTT(...) 4882-4912 pol CAAAAAUUCAAAAUUUUCGGGUUUAUUACA(...) 20
HIV1ID0071 Primer Recombinase Polymerase Amplifi(...) Primer reverse pol R3 34 CCCGAAAATTTTGAATTTTTGTAATTTGTT(...) 4869-4902 pol CAAAAACAAAUUACAAAAAUUCAAAAUUUU(...) 20
HIV1ID0072 Primer Recombinase Polymerase Amplifi(...) Primer reverse pol R4 33 TAATTCTTTAGTTTGTATGTCTGTTGCTAT(...) 4836-4868 pol AUAAUAGCAACAGACAUACAAACUAAAGAA(...) 20
HIV1ID0073 PCR primer pair Taqman real-time quantative PC(...) Primer forward polP1 19 199 TGGCATGGGTACCAGCACA 4147-4165 pol UGGCAUGGGUACCAGCACA 21
HIV1ID0074 PCR primer pair Taqman real-time quantative PC(...) Primer reverse polP2 22 CTGGCTACTATTTCTTTTGCTA 4324-4345 pol UAGCAAAAGAAAUAGUAGCCAG 21
HIV1ID0075 Probe Taqman real-time quantative PC(...) Probe polprobe 32 TTTATCTACTTGTTCATTTCCTCCAATTCC(...) 4168-4199 pol AAGGAAUUGGAGGAAAUGAACAAGUAGAUA(...) 21
HIV1ID0076 PCR primer pair Taqman real-time quantative PC(...) Primer forward gagFW 25 166 TTAAGTGTTTCAATTGTGGCAAAGA 1958-1982 gag UUAAGUGUUUCAAUUGUGGCAAAGA 21
HIV1ID0077 PCR primer pair Taqman real-time quantative PC(...) Primer reverse gagRW 30 AAAAAATTAGCCTGTCTCTCAGTACAATCT 2061-2090 gag AGAUUGUACUGAGAGACAGGCUAAUUUUUU 21
HIV1ID0078 Probe Taqman real-time quantative PC(...) Probe gagprobe 27 CCCTAGGAAAAAGGGCTGTTGGAAATG 2010-2036 gag CCCUAGGAAAAAGGGCUGUUGGAAAUG 21
HIV1ID0079 Sequencing primer Sequencing Primer forward G00 19 GACTAGCGGAGGCTAGAAG 764-782 gag GACUAGCGGAGGCUAGAAG 15
HIV1ID0080 Sequencing primer Sequencing Primer forward G10 22 CAGTATTAAGCGGGGGAGAATT 806-827 gag CAGUAUUAAGCGGGGGAGAAUU 15
HIV1ID0081 Sequencing primer Sequencing Primer forward G20 24 GTATGGGCAAGCAGGGAGCTAGAA 892-915 gag GUAUGGGCAAGCAGGGAGCUAGAA 15
HIV1ID0082 Sequencing primer Sequencing Primer forward G30 22 CAGTAGCAACCCTCTATTGTGT 1031-1052 gag CAGUAGCAACCCUCUAUUGUGU 15
HIV1ID0083 Sequencing primer Sequencing Primer forward G40 20 GACACCAAGGAAGCTTTAGA 1075-1094 gag GACACCAAGGAAGCUUUAGA 15
HIV1ID0084 Sequencing primer Sequencing Primer forward G50 18 CACAGCAAGCAGCAGCTG 1133-1150 gag CACAGCAAGCAGCAGCUG 15
HIV1ID0085 Sequencing primer Sequencing Primer forward G60 25 CAGCCAAAATTACCCTATAGTGCAG 1173-1197 gag CAGCCAAAAUUACCCUAUAGUGCAG 15
HIV1ID0086 Sequencing primer Sequencing Primer forward G70 21 ATGAGGAAGCTGCAGAATGGG 1406-1426 gag AUGAGGAAGCUGCAGAAUGGG 15
HIV1ID0087 Sequencing primer Sequencing Primer forward G80 23 ATGAGAGAACCAAGGGGAAGTGA 1471-1493 gag AUGAGAGAACCAAGGGGAAGUGA 15
HIV1ID0088 Sequencing primer Sequencing Primer forward G100 18 TAGAAGAAATGATGACAG 1817-1834 gag UAGAAGAAAUGAUGACAG 15
HIV1ID0089 Sequencing primer Sequencing Primer forward G110 18 AGGCTAATTTTTTAGGGA 2078-2095 gag AGGCUAAUUUUUUAGGGA 15
HIV1ID0090 Sequencing primer Sequencing Primer reverse G01 18 AGGGGTCGTTGCCAAAGA 2264-2281 gag UCUUUGGCAACGACCCCU 15
HIV1ID0091 Sequencing primer Sequencing Primer reverse G05 20 TGTTGGCTCTGGTCTGCTCT 2138-2157 gag AGAGCAGACCAGAGCCAACA 15
HIV1ID0092 Sequencing primer Sequencing Primer reverse G15 22 CTTTGCCACAATTGAAACACTT 1960-1981 gag AAGUGUUUCAAUUGUGGCAAAG 15
HIV1ID0093 Sequencing primer Sequencing Primer reverse G25 23 ATTGCTTCAGCCAAAACTCTTGC 1867-1889 gag GCAAGAGUUUUGGCUGAAGCAAU 15
HIV1ID0094 Sequencing primer Sequencing Primer reverse G35 22 CATGCTGTCATCATTTCTTCTA 1817-1838 gag UAGAAGAAAUGAUGACAGCAUG 15
HIV1ID0095 Sequencing primer Sequencing Primer reverse G45 22 TTGGACCAACAAGGTTTCTGTC 1740-1761 gag GACAGAAACCUUGUUGGUCCAA 15
HIV1ID0096 Sequencing primer Sequencing Primer reverse G65 18 ATGCTGAAAACATGGGTA 1295-1312 gag UACCCAUGUUUUCAGCAU 15
HIV1ID0097 Sequencing primer Sequencing Primer reverse G85 20 TGCACTATAGGGTAATTTTG 1177-1196 gag CAAAAUUACCCUAUAGUGCA 15
HIV1ID0098 Sequencing primer Sequencing Primer forward E0 33 TAGAGCCCTGGAAGCATCCAGGAAGTCAGC(...) 5853-5885 env UAGAGCCCUGGAAGCAUCCAGGAAGUCAGC(...) 15
HIV1ID0099 Sequencing primer Sequencing Primer forward E00 28 TAGAAAGAGCAGAAGACAGTGGCAATGA 6201-6228 env UAGAAAGAGCAGAAGACAGUGGCAAUGA 15
HIV1ID0100 Sequencing primer Sequencing Primer forward E10 26 TTGTGGGTCACAGTCTATTATGGGGT 6324-6349 env UUGUGGGUCACAGUCUAUUAUGGGGU 15
HIV1ID0101 Sequencing primer Sequencing Primer forward E20 27 GGGCCACACATGCCTGTGTACCCACAG 6430-6456 env GGGCCACACAUGCCUGUGUACCCACAG 15
HIV1ID0102 Sequencing primer Sequencing Primer forward E30 27 GTGTACCCACAGACCCCAGCCCACAAG 6445-6471 env GUGUACCCACAGACCCCAACCCACAAG 15
HIV1ID0103 Sequencing primer Sequencing Primer forward E40 27 CATGTGGAAAAATGACATGGTGGATCA 6506-6532 env CAUGUGGAAAAAUGACAUGGUAGAACA 15
HIV1ID0104 Sequencing primer Sequencing Primer forward E50 26 CATGGTAGAGCAGATGCAGGAGGATG 6521-6546 env CAUGGUAGAACAGAUGCAUGAGGAUA 15
HIV1ID0105 Sequencing primer Sequencing Primer forward E60 23 TAATCAGTTTATGGGATCAAAGC 6547-6569 env UAAUCAGUUUAUGGGAUCAAAGC 15
HIV1ID0106 Sequencing primer Sequencing Primer forward E70 27 GGGATCAAAGCCTAAAGCCATGTGTAA 6559-6585 env GGGAUCAAAGCCUAAAGCCAUGUGUAA 15
HIV1ID0107 Sequencing primer Sequencing Primer forward E80 22 CCAATTCCCATACATTATTGTG 6858-6879 env CCAAUUCCCAUACAUUAUUGUG 15
HIV1ID0108 Sequencing primer Sequencing Primer forward E90 24 CACAGTACAATGTACACATGGAAT 6953-6976 env CACAGUACAAUGUACACAUGGAAU 15
HIV1ID0109 Sequencing primer Sequencing Primer forward E100 20 ACACATGGAATTAAGCCAGT 6966-6985 env ACACAUGGAAUUAGGCCAGU 15
HIV1ID0110 Sequencing primer Sequencing Primer forward E110 24 CTGTTAAATGGCAGTCTAGCAGAA 7002-7025 env CUGUUAAAUGGCAGUCUAGCAGAA 15
HIV1ID0111 Sequencing primer Sequencing Primer forward E120 24 GTAGAAATTAATTGTACAAGACCC 7098-7121 env GUAGAAAUUAAUUGUACAAGACCC 15
HIV1ID0112 Sequencing primer Sequencing Primer forward E130 23 ACAAATTATAAACATGTGGCAGG 7487-7509 env ACAAAUUAUAAACAUGUGGCAGA 15
HIV1ID0113 Sequencing primer Sequencing Primer forward E140 24 GTGAATTATATAAATATAAAGTAG 7666-7689 env GUGAAUUAUAUAAAUAUAAAGUAG 15
HIV1ID0114 Sequencing primer Sequencing Primer forward E160 27 GTGGGAATAGGAGCTGTGTTCCTTGGG 7761-7787 env GUGGGAAUAGGAGCUUUGUUCCUUGGG 15
HIV1ID0115 Sequencing primer Sequencing Primer forward E170 18 AGCAGGAAGCACTATGGG 7799-7816 env AGCAGGAAGCACUAUGGG 15
HIV1ID0116 Sequencing primer Sequencing Primer forward E180 20 GTCTGGTATAGTGCAACAGCA 7860-7879 env UCUGGUAUAGUGCAGCAGCA 15
HIV1ID0117 Sequencing primer Sequencing Primer forward E210 24 TAACAAATTGGCTGTGGTATATAA 8248-8271 env UAACAAAUUGGCUGUGGUAUAUAA 15
HIV1ID0118 Sequencing primer Sequencing Primer forward E260 25 TTCAGCTACCACCGCTTGAGAGACT 8520-8544 env UUCAGCUACCACCGCUUGAGAGACU 15
HIV1ID0119 Sequencing primer Sequencing Primer forward E270 20 GTGGAACTTCTGGGACGCAG 8568-8587 env GUGGAACUUCUGGGACGCAG 15
HIV1ID0120 Sequencing primer Sequencing Primer reverse E01 26 TCCAGTCCCCCCTTTTCTTTTAAAAA 9064-9089 env UUUUUAAAAGAAAAGGGGGGACUGGA 15
HIV1ID0121 Sequencing primer Sequencing Primer reverse E03 26 TAAGTCATTGGTCTTAAAGGTACCTG 9013-9038 env CAGGUACCUUUAAGACCAAUGACUUA 15
HIV1ID0122 Sequencing primer Sequencing Primer reverse E05 22 TATTTGAGGGCTTCCCACCCCC 8587-8608 env GGGGGUGGGAAGCCCUCAAAUA 15
HIV1ID0123 Sequencing primer Sequencing Primer reverse E15 22 CTCTCTCTCCACCTTCTTCTTC 8424-8445 env GAAGAAGAAGGUGGAGAGAGAG 15
HIV1ID0124 Sequencing primer Sequencing Primer reverse E45 19 CCTGCCTAACTCTATTCAC 8337-8355 env GUGAAUAGAGUUAGGCAGG 15
HIV1ID0125 Sequencing primer Sequencing Primer reverse E55 27 GCCCCAGACTGTGAGTTGCAACAGATG 7914-7940 env CAUCUGUUGCAACUCACAGUCUGGGGC 15
HIV1ID0126 Sequencing primer Sequencing Primer reverse E65 18 AGTGCTTCCTGCTGCTCC 7794-7811 env GGAGCAGCAGGAAGCACU 15
HIV1ID0127 Sequencing primer Sequencing Primer reverse E75 27 GCGCCCATAGTGCTTCCTGCTGCTCCC 7793-7819 env GGGAGCAGCAGGAAGCACUAUGGGCGC 15
HIV1ID0128 Sequencing primer Sequencing Primer reverse E85 27 GTCCCTCATATCTCCTCCTCCAGGTCT 7629-7655 env AGACCUGGAGGAGGAGAUAUGAGGGAC 15
HIV1ID0129 Sequencing primer Sequencing Primer reverse E95 18 GATGGGAGGGGCATACAT 7524-7541 env AUGUAUGCCCCUCCCAUC 15
HIV1ID0130 Sequencing primer Sequencing Primer reverse E105 21 GCTTTTCCTACTTCCTGCCAC 7512-7532 env GUAGGAAAAGCAAUGUAUGCC 15
HIV1ID0131 Sequencing primer Sequencing Primer reverse E115 24 AGAAAAATTCCCCTCCACAATTAA 7351-7374 env UUAAUUGUGGAGGGGAAUUUUUCU 15
HIV1ID0132 Sequencing primer Sequencing Primer reverse E125 24 CAATTTCTGGGTCCCCTCCTGAGG 7315-7338 env CCUCAGGAGGGGACCCAGAAAUUG 15
HIV1ID0133 Sequencing primer Sequencing Primer reverse E135 28 AGCTGTACTATTATGGTTTTAGCATTGT 7060-7087 env ACAAUGCUAAAACCAUAAUAGUACAGCU 15
HIV1ID0134 Sequencing primer Sequencing Primer reverse E145 24 CAGCAGTTGAGTTGATACTACTGG 6981-7004 env CCAGUAGUAUCAACUCAACUGCUG 15
HIV1ID0135 Sequencing primer Sequencing Primer reverse E165 27 GGGGTCTGTGGGTACACAGGCATGTGT 6435-6461 env ACACAUGCCUGUGUACCCACAGACCCC 15
HIV1ID0136 Sequencing primer Sequencing Primer reverse E175 24 TTTAGCATCTGATGCACAAAATAG 6378-6401 env CUAUUUUGUGCAUCAGAUGCUAAA 15
HIV1ID0137 Primer cDNA synthesis Degenerated primer forward GAG2FWD 21 RGAYATAARRCARGGRCCAAA 1638-1658 gag GGACAUAAGACAAGGACCAAA 22
HIV1ID0138 Primer cDNA synthesis Degenerated primer reverse GAG2REV 22 CTTKCCACAYTTCCARCARCCC 2022-2043 gag GGGCUGUUGGAAAUGUGGAAAG 22
HIV1ID0139 Primer Nested PCR Degenerated primer reverse M/Op24-7 18 CCCTGRCAKGCTYCATCA 1834-1851 gag GCAUGUCAGGGAGUAGGA 23
HIV1ID0140 Primer Nested PCR Degenerated primer forward M/Op24-1 20 AGYCAAAATTWYCCYATAGT 1174-1193 gag AGCCAAAAUUACCCUAUAGU 23
HIV1ID0141 Primer Nested PCR Degenerated primer forward M/Op24-2 20 AGRACYTTRAAYGCATGGGT 1237-1256 gag AGAACUUUAAAUGCAUGGGU 23
HIV1ID0142 Primer Nested PCR Degenerated primer reverse M/Op24-6 19 TGTGWAGCTTGYTCRGCTC 1703-1721 gag GAGCCGAGCAAGCUUCACA 23
HIV1ID0143 Primer Nested PCR Degenerated primer reverse M/Op24-4 19 ATKTCTCCYACTGGRAYAG 1553-1571 gag CUAUCCCAGUAGGAGAAAU 23
HIV1ID0144 Primer Nested PCR Degenerated primer reverse JH38 20 GGTGARTATCCCTKCCTAAC 8346-8365 env GUUAGGCAGGGAUAUUCACC 23
HIV1ID0145 Primer Nested PCR Degenerated primer forward JH41 19 CAGCAGGAAGCACUAUGGG 7798-7816 env CAGCAGGAAGCACUAUGGG 23
HIV1ID0146 Primer Nested PCR Degenerated primer forward env27F 19 CTGGYATAGTGCARCARCA 7861-7879 env CUGGUAUAGUGCAGCAGCA 23
HIV1ID0147 Primer Nested PCR Degenerated primer reverse menv19R 22 AARCCTCCTACTATCATTATRA 8278-8299 env UCAUAAUGAUAGUAGGAGGCUU 23
HIV1ID0148 Primer Nested PCR Degenerated primer forward JH37 19 GTCTGGGGCATYAARCAGC 7932-7950 env GUCUGGGGCAUCAAGCAGC 23
HIV1ID0149 Primer Nested PCR Degenerated primer forward menv17F 20 TYAARCAGCTCCAGRCAAGA 7942-7961 env UCAAGCAGCUCCAGGCAAGA 23
HIV1ID0150 Primer Nested PCR Degenerated primer reverse JH42 20 CCAAYTCCACARAYTTKCCC 8221-8240 env GGGCAAGUUUGUGGAAUUGG 23
HIV1ID0151 Probe Multiplex real-time PCR & Flow(...) SK102 33 GAGACCATCAATGAGGAAGCTGCAGAATGG(...) 1396-1428 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 7
HIV1ID0152 Primer pair Multiplex real-time PCR & Flow(...) SK431 27 TGCTATGTCAGTTCCCCTTGGTTCTCT 1491-1517 gag UGACAUAGCAGGAACUACUAGUACCCU 7
HIV1ID0153 Primer pair One-step RT-PCR Primer forward Pan-HIV-1_1F 17 1928 AGCCYGGGAGCTCTCTG 480-496 LTR AGCCUGGGAGCUCUCUG 24
HIV1ID0154 Primer pair One-step RT-PCR Primer reverse Pan-HIV-1_1R 23 CCTCCAATTCCYCCTATCATTTT 2385-2407 pol AAAAUGAUAGGGGGAAUUGGAGG 24
HIV1ID0155 Primer pair One-step RT-PCR Primer forward Pan-HIV-1_2F 21 3574 GGGAAGTGAYATAGCWGGAAC 1485-1505 gag GGGAAGUGACAUAGCAGGAAC 24
HIV1ID0156 Primer pair One-step RT-PCR Primer reverse Pan-HIV-1_2R 22 CTGCCATCTGTTTTCCATARTC 5037-5058 pol GAUUAUGGAAAACAGAUGGCAG 24
HIV1ID0157 Primer pair One-step RT-PCR Primer forward Pan-HIV-1_3F 23 3066 TTAAAAGAAAAGGGGGGATTGGG 4783-4805 pol UUAAAAGAAAAGGGGGGAUUGGG 24
HIV1ID0158 Primer pair One-step RT-PCR Primer reverse Pan-HIV-1_3R 18 TGGCYTGTACCGTCAGCG 7831-7848 env CGCUGACGGUACAGGCCA 24
HIV1ID0159 Primer pair One-step RT-PCR Primer forward Pan-HIV-1_4F 19 3551 CCTATGGCAGGAAGAAGCG 5967-5985 env CCUAUGGCAGGAAGAAGCG 24
HIV1ID0160 Primer pair One-step RT-PCR Primer reverse Pan-HIV-1_4R 21 CTT WTA TGC AGC WTC TGA GGG 9497-9517 LTR CCCUCAGAUCCUGCAUAUAAG 24
HIV1ID0161 Primer pair PCR Primer forward RU5F 20 170 TTAAGCCTCAATAAAGCTTG 518-537 LTR UUAAGCCUCAAUAAAGCUUG 25
HIV1ID0162 Primer pair PCR Primer reverse RU5R 26 GCGCCACTGCTAGAGATTTTCCACAC 616-641 LTR GUGUGGAAAAUCUCUAGCAGUGGCGC 25
HIV1ID0163 Primer pair PCR Primer forward intF 20 425 CCCTACAATCCCCAAAGTCA 4653-4672 pol CCCUACAAUCCCCAAAGUCA 25
HIV1ID0164 Primer pair PCR Primer reverse intR 20 CTTGCCACACAATCATCACC 5058-5077 pol GGUGAUGAUUGUGUGGCAAG 25
HIV1ID0165 Primer pair PCR Primer forward tatF 20 118 GAAGCATCCAGGAAGTCAGC 5863-5882 env GAAGCAUCCAGGAAGUCAGC 25
HIV1ID0166 Primer pair PCR Primer reverse tatR 20 CTTCCTGCCATAGGAGATGC 5961-5980 env GCAUCUCCUAUGGCAGGAAG 25
HIV1ID0167 Primer pair PCR Primer forward vprF 19 162 AACAAGCCCCAGAAGACCA 5563-5581 env AACAAGCCCCAGAAGACCA 25
HIV1ID0168 Primer pair PCR Primer reverse vprR 19 CTGCCCAAGTATCCCCATA 5706-5724 env UAUGGGGAUACUUGGGCAG 25
HIV1ID0169 Primer Real-time PCR Primer reverse B3 21 CCTACATACAAATCATCCATG 3098-3118 pol CAUGGAUGAUUUGUAUGUAGG 26
HIV1ID0170 Primer Real-time PCR Primer reverse F3 21 AGTTCCCTTAGATAAAGACTT 2900-2920 pol AGUUCCCUUAGAUGAAGACUU 26
HIV1ID0171 Primer Recombinase Polymerase Amplifi(...) Primer reverse GAGR1 20 TTATTGTGACGAGGGGTCGC 2273-2292 gag ACGACCCCUCGUCACAAUAA 27
HIV1ID0172 Primer pair Real-time PCR Primer forward 5' Repliprimer 20 263 CCAGGAAGATGGAAACCAAA 2367-2386 pol CCAGGAAGAUGGAAACCAAA 28
HIV1ID0173 Primer pair Real-time PCR Primer reverse 3' Repliprimer 20 GTCAATGGCCATTGTTTAAC 2610-2629 pol GUUAAACAAUGGCCAUUGAC 28
HIV1ID0174 Probe Real-time PCR Probe Repliprobe 24 TGTCTTACTTTGATAAAACCTCC 2403-2426 pol GGAGGUUUUAUCAAAGUAAGACAG 28
HIV1ID0175 Primer PCR Primer forward AV1O 30 TGTGACTCTGGTAACTAGAGATCCCTCAGA 574-603 LTR UGUGACUCUGGUAACUAGAGAUCCCUCAGA 29
HIV1ID0176 Primer PCR Primer forward AV11 15 TCTAGCAGTGGCGCC 628-642 LTR UCUAGCAGUGGCGCC 29
HIV1ID0177 Primer PCR Primer reverse AV12 15 GACGCTCTCGCACCC 792-806 gag GGGUGCGAGAGCGUC 29
HIV1ID0178 Primer PCR Primer reverse AV13 29 GGCAAGCAGGGAGCTAGAACGATTCGCAG 897-925 gag GGCAAGCAGGGAGCUAGAACGAUUCGCAG 29
HIV1ID0179 Primer Nested PCR Primer forward HPOL4235 23 CCCTACAATCCCCAAAGTCAAGG 4653-4675 pol CCCUACAAUCCCCAAAGUCAAGG 30
HIV1ID0180 Primer Nested PCR Primer reverse HPOL4538 22 TACTGCCCCTTCACCTTTCCA 4956-4976 pol UGGAAAGGUGAAGGGGCAGUA 30
HIV1ID0181 Primer Nested PCR Primer forward HPOL4327 23 TAAGACAGCAGTACAAATGGCAG 4745-4767 pol UAAGACAGCAGUACAAAUGGCAG 30
HIV1ID0182 Primer Nested PCR Primer reverse HPOL4481 21 GCTGTCCCTGTAATAAACCCG 4899-4919 pol CGGGUUUAUUACAGGGACAGC 30
HIV1ID0183 Primer Nested PCR Primer forward HENV5944 26 GCAACCACCACTCTCTATTTTGTGC 6366-6391 env GCAACCACCACUCUAUUUUGUGCAUC 30
HIV1ID0184 Primer Nested PCR Primer reverse HENV6154 25 AGAGTGGGGTTAATTTTACACATGG 6576-6600 env CCAUGUGUAAAAUUAACCCCACUCU 30
HIV1ID0185 Primer Nested PCR Primer forward HENV6009 20 GGCCACACATGCCTGTGTAC 6431-6450 env GGCCACACAUGCCUGUGUAC 30
HIV1ID0186 Primer Nested PCR Primer reverse HENV6135 21 GGCTTTAGGCTTTGATCCCAT 6557-6577 env AUGGGAUCAAAGCCUAAAGCC 30
HIV1ID0187 Primer Nested PCR Primer forward AV18 30 GCACCCACCAAGGCAAAGAGAAGAGTGGTG 7713-7742 env GCACCCACCAAGGCAAAGAGAAGAGUGGUG 29
HIV1ID0188 Primer Nested PCR Primer forward AV19 16 AGGAAGCACTATGGGC 7802-7817 env AGGAAGCACUAUGGGC 29
HIV1ID0189 Primer Nested PCR Primer reverse AV20 16 GCTGCTTGATGCCCCA 7935-7950 env UGGGGCAUCAAGCAGC 29
HIV1ID0190 Primer Nested PCR Primer reverse AV21 27 TCCACAGCCAGGACTCTTGCCTGGAGCTG 7949-7975 env GCUCCAGGCAAGAAUCCUGGCUGUGGA 29
HIV1ID0191 Primer pair RT-LAMP Primer forward p24F3 19 225 ATTATCAGAAGGAGCCACC 1311-1329 gag AUUAUCAGAAGGAGCCACC 31
HIV1ID0192 Primer pair RT-LAMP Primer reverse p24B3 21 CATCCTATTTGTTCCTGAAGG 1515-1535 gag CCUUCAGGAACAAAUAGGAUG 31
HIV1ID0193 Primer pair RT-LAMP Primer forward p24LoopF 25 124 TTTAACATTTGCATGGCTGCTTGAT 1370-1394 gag AUCAAGCAGCCAUGCAAAUGUUAAA 31
HIV1ID0194 Primer pair RT-LAMP Primer reverse p24LoopR 19 GAGATCCAAGGGGAAGTGA 1475-1493 gag GAGAACCAAGGGGAAGUGA 31
HIV1ID0195 Primer pair RT-LAMP Primer forward proteaseF3 18 211 AAAGATAGGGGGGCAACT 2291-2308 gag AAAGAUAGGGGGGCAACU 31
HIV1ID0196 Primer pair RT-LAMP Primer reverse proteaseB3 20 GTTGACAGGTGTAGGTCCTA 2482-2501 gag UAGGACCUACACCUGUCAAC 31
HIV1ID0197 Primer pair RT-LAMP Primer forward proteaseLoopF 22 95 TATTTCTTCTAATACTGTATCA 2334-2355 gag GCAGAUGAUACAGUAUUAGAAG 31
HIV1ID0198 Primer pair RT-LAMP Primer reverse proteaseLoopR 18 TATCAAAGTAAGACAGTA 2411-2428 gag UAUCAAAGUAAGACAGUA 31
HIV1ID0199 Primer pair Alu-PCR Primer forward MH531 20 143 TGTGTGCCCGTCTGTTGTGT 557-576 LTR UGUGUGCCCGUCUGUUGUGU 32
HIV1ID0200 Primer pair Alu-PCR Primer reverse MH532 20 GAGTCCTGCGTCGAGAGAGC 680-699 LTR GCUCUCUCGACGCAGGACUC 32
HIV1ID0201 Probe Alu-PCR Probe LRT-P 20 CAGTGGCGCCCGAACAGGGA 633-652 LTR CAGUGGCGCCCGAACAGGGA 32
HIV1ID0202 Primer pair Alu-PCR Primer forward MH535 23 AACTAGGGAACCCACTGCTTAAG 500-522 LTR AACUAGGGAACCCACUGCUUAAG 32
HIV1ID0203 Primer pair Alu-PCR Primer reverse MH536 24 TCCACAGATCAAGGATATCTTGTC 28-51 LTR GACAAGAUAUCCUUGAUCUGUGGA 32
HIV1ID0204 Probe Alu-PCR Probe MH603 30 ACACTACTTGAAGCACTCAAGGCAAGCTTT 530-559 LTR AAAGCUUGCCUUGAGUGCUUCAAGUAGUGU 32
HIV1ID0205 Primer pair qRT-PCR PCR primer forward "HIV-1" 22 CCAAAGTAGCATGACAAAAATC 3029-3050 pol CCAAAGUAGCAUGACAAAAAUC 42
HIV1ID0206 Primer pair qRT-PCR PCR primer reverse "HIV-1" 28 GTTCATAACCCATCCAAAGGAATGGAGG 3222-3249 pol CCUCCAUUCCUUUGGAUGGGUUAUGAAC 42
HIV1ID0207 Probe PCR Probe "Proviral HIV-1" 26 AGTAGTGTGTGCCCGTCTGTTTAMRA 9637-9662 LTR AGUAGUGUGUGCCCGUCUGUUGUGUG 43
HIV1ID0208 Primer pair PCR PCR primer forward "Proviral HIV-1" 22 GGTCTCTCTGGTTAGACCAGAT 455-476 LTR GGUCUCUCUGGUUAGACCAGAU 43
HIV1ID0209 Primer pair PCR PCR primer reverse "Proviral HIV-1" 22 CTGCTAGAGATTTTCCACACTG 614-635 LTR CAGUGUGGAAAAUCUCUAGCAG 43
HIV1ID0210 Primer Site-directed mutagenesis PCR primer "XS 431V R" 33 GAGAGACAGGTTAATTTTTTAGGGAAGATC(...) 2071-2104 gag GAGAGACAGGCUAAUUUUUUAGGGAAGAUC(...) 44
HIV1ID0211 Primer Site-directed mutagenesis PCR primer "XS 431V F" 33 CCAGATCTTCCCTAAAAAATTAACCTGTCT(...) 2091-2124 gag AGGGAAGAUCUGGCCUUCCUACAAGGGAAG(...) 44
HIV1ID0212 Primer Site-directed mutagenesis PCR primer "V18BS 431 AR" 30 CCCTAAAAAATTAGCCTGTCTCTCAGTACA 2065-2094 gag UGUACUGAGAGACAGGCUAAUUUUUUAGGG 44
HIV1ID0213 Primer Site-directed mutagenesis PCR primer "V18BS 431 AF" 30 TGTACTGAGAGACAGGCTAATTTTTTAGGG 2065-2094 gag UGUACUGAGAGACAGGCUAAUUUUUUAGGG 44
HIV1ID0214 Primer Site-directed mutagenesis PCR primer "V16XS 437 VR" 30 CCTTGTGGGAAGGCCAGACCTTCCCTAAAA 61-90 5'LTR CACAAGGCUACUUCCCUGAUUAGCAGAACU 44
HIV1ID0215 Primer Site-directed mutagenesis PCR primer "V16XS 437 VF" 30 TTTTAGGGAAGGTCTGGCCTTCCCACAAGG 2087-2116 gag UUUUAGGGAAGAUCUGGCCUUCCUACAAGG 44
HIV1ID0216 Primer Site-directed mutagenesis PCR primer "V16BS 437 IR" 34 GGGGGAAGGCCAGATCTTCCCTAAAAAATT(...) 2079-2112 gag GGCUAAUUUUUUAGGGAAGAUCUGGCCUUC(...) 44
HIV1ID0217 Primer Site-directed mutagenesis PCR primer "V16BS 437 IF" 34 GGCTAATTTTTTAGGGAAGATCTGGCCTTC(...) 2079-2112 gag GGCUAAUUUUUUAGGGAAGAUCUGGCCUUC(...) 44
HIV1ID0218 Primer Site-directed mutagenesis PCR primer "V13BS 431AR" 26 CCCTAAAAAATTAGCCTGTCTCTCAG 2069-2094 gag CUGAGAGACAGGCUAAUUUUUUAGGG 44
HIV1ID0219 Primer Site-directed mutagenesis PCR primer "V13BS 431AF" 26 CTGAGAGACAGGCTAATTTTTTAGGG 2069-2094 gag CUGAGAGACAGGCUAAUUUUUUAGGG 44
HIV1ID0220 Primer pair PCR PCR primer forward "5'HIV-TR-16" 26 CCTCTATTGTGTGCATCAAAGGATAG 1041-1066 gag CCUCUAUUGUGUGCAUCAAAGGAUAG 45
HIV1ID0221 Primer pair PCR PCR primer reverse "5'HIV-TR-16" 26 GGCTTCCTTGGTGTCTTTTACATCTA 1089-1114 gag UUUAGACAAGAUAGAGGAAGAGCAAA 45
HIV1ID0222 Primer pair PCR PCR primer forward "5'HIV-TR-15" 23 ACAACCATCCCTTCAGACAGGAT 981-1003 gag ACAACCAUCCCUUCAGACAGGAU 45
HIV1ID0223 Primer pair PCR PCR primer reverse "5'HIV-TR-15" 25 CCTTTGATGCACACAATCGAGGACT 1038-1062 gag AACCCUCUAUUGUGUGCAUCAAAGG 45
HIV1ID0224 Primer pair PCR PCR primer forward "5'HIV-TR-14" 22 ACTGGGACAGCTACAACCATCC 969-990 gag ACUGGGACAGCUACAACCAUCC 45
HIV1ID0225 Primer pair PCR PCR primer reverse "5'HIV-TR-14" 25 AAGTTCTTCTGATCCTGTCTGAAGG 990-1014 gag CCUUCAGACAGGAUCAGAAGAACUU 45
HIV1ID0226 Primer pair PCR PCR primer forward "5'HIV-TR-13" 26 GAGACATCAGAAGGCTGTAGACAAAT 923-943 gag CAGUUAAUCCUGGCCUGUUAG 45
HIV1ID0227 Primer pair PCR PCR primer reverse "5'HIV-TR-13" 21 GGATGGTTGTAGCTGTCCCAG 970-990 gag CUGGGACAGCUACAACCAUCC 45
HIV1ID0228 Primer pair PCR PCR primer forward "5'HIV-TR-12" 22 GATTCGCAGTTAATCCTGGCCT 918-938 gag AUUCGCAGUUAAUCCUGGCCU 45
HIV1ID0229 Primer pair PCR PCR primer reverse "5'HIV-TR-12" 28 CCAGTATTTGTCTACAGCCTTCTGATGT 946-973 gag ACAUCAGAAGGCUGUAGACAAAUACUGG 45
HIV1ID0230 Primer pair PCR PCR primer forward "5'HIV-TR-11" 21 GGGAGCTAGAACGATTCGCAG 905-925 gag GGGAGCUAGAACGAUUCGCAG 45
HIV1ID0231 Primer pair PCR PCR primer reverse "5'HIV-TR-11" 26 CTGATGTCTCTAAAAGGCCAGGATTA 927-952 gag UAAUCCUGGCCUGUUAGAAACAUCAG 45
HIV1ID0232 Primer pair PCR PCR primer forward "5'HIV-TR-10" 21 AAAATTCGGTTAAGGCCAGGG 841-861 gag AAAAUUCGGUUAAGGCCAGGG 45
HIV1ID0233 Primer pair PCR PCR primer reverse "5'HIV-TR-10" 25 GGATTAACTGCGAATCGTTCTAGCT 908-932 gag AGCUAGAACGAUUCGCAGUUAAUCC 45
HIV1ID0234 Primer pair PCR PCR primer forward "5'HIV-TR-8" 23 GCGGAGGCTAGAAGGAGAGAGAT 769-791 LTR GCGGAGGCUAGAAGGAGAGAGAU 45
HIV1ID0235 Primer pair PCR PCR primer reverse "5'HIV-TR-8" 21 TAATACCGACGCTCTCGCACC 813-835 gag AAGCGGGGGAGAAUUAGAUCGAU 45
HIV1ID0236 Primer pair PCR PCR primer forward "5'HIV-TR-9" 21 GCGAGAGCGTCGGTATTAAGC 796-816 gag GCGAGAGCGUCAGUAUUAAGC 45
HIV1ID0237 Primer pair PCR PCR primer reverse "5'HIV-TR-9" 19 TTTCCCCCTGGCCTTAACC 848-866 gag GGUUAAGGCCAGGGGGAAA 45
HIV1ID0238 Primer pair PCR PCR primer forward "5'HIV-TR-7" 21 CGACTGGTGAGTACGCCAAAA 738-758 LTR CGACUGGUGAGUACGCCAAAA 45
HIV1ID0239 Primer pair PCR PCR primer reverse "5'HIV-TR-7" 23 ATCTCTCTCCTTCTAGCCTCCGC 769-791 LTR GCGGAGGCUAGAAGGAGAGAGAU 45
HIV1ID0240 Primer pair PCR PCR primer forward "5'HIV-TR-6" 20 CAGGACTCGGCTTGCTGAAG 692-711 LTR CAGGACUCGGCUUGCUGAAG 45
HIV1ID0241 Primer pair PCR PCR primer reverse "5'HIV-TR-6" 15 CACCAGTCGCCGCCC 732-746 LTR GGGCGGCGACUGGUG 45
HIV1ID0242 Primer pair PCR PCR primer forward "5'HIV-TR-5" 16 GTGGCGCCCGAACAGG 635-650 LTR GUGGCGCCCGAACAGG 45
HIV1ID0243 Primer pair PCR PCR primer reverse "5'HIV-TR-5" 15 TTGCCGTGCGCGCTT 709-723 LTR AAGCGCGCACGGCAA 45
HIV1ID0244 Primer pair PCR PCR primer forward "5'HIV-TR-4" 25 GAGATCCCTCAGACCCTTTTAGTCA 591-615 5'LTR GAGAUCCCUCAGACCCUUUUAGUCA 45
HIV1ID0245 Primer pair PCR PCR primer reverse "5'HIV-TR-4" 19 TTCAAGTCCCTGTTCGGGC 640-658 LTR GCCCGAACAGGGACCUGAA 45
HIV1ID0246 Primer pair PCR PCR primer forward "5'HIV-TR-3" 21 AGTGTGTGCCCGTCTGTTGTG 555-575 5'LTR AGUGUGUGCCCGUCUGUUGUG 45
HIV1ID0247 Primer pair PCR PCR primer reverse "5'HIV-TR-3" 27 TGACTAAAAGGGTCTGAGGGATCTCTA 589-615 5'LTR UAGAGAUCCCUCAGACCCUUUUAGUCA 45
HIV1ID0248 Primer pair PCR PCR primer forward "5'HIV-TR-2" 23 AAGCCTCAATAAAGCTTGCCTTG 520-542 5'LTR AAGCCUCAAUAAAGCUUGCCUUG 45
HIV1ID0249 Primer pair PCR PCR primer reverse "5'HIV-TR-2" 21 AGTCACACAACAGACGGGCAC 560-580 5'LTR GUGCCCGUCUGUUGUGUGACU 45
HIV1ID0250 Primer pair PCR PCR primer forward "5'HIV-TR-1" 23 TCTCTGGCTAACTAGGGAACCCA 491-513 5'LTR UCUCUGGCUAACUAGGGAACCCA 45
HIV1ID0251 Primer pair PCR PCR primer reverse "5'HIV-TR-1" 23 GCACTCAAGGCAAGCTTTATTGA 525-547 5'LTR UCAAUAAAGCUUGCCUUGAGUGC 45
HIV1ID0252 Primer pair PCR PCR primer forward "LEX074" 17 AAGAGTGCTCCCGTGTG 7733-7749 env AAGAGUGGUGCAGAGAG 46
HIV1ID0253 Primer pair PCR PCR primer reverse "LEX074" 20 GACAATGCAGAACTGGGTAA 7059-7078 env GACAAUGCUAAAACCAUAAU 46
HIV1ID0254 siRNA Gene silencing siRNA sense "siControl" 21 GUACCGCACGUCAUUCGUAUC 7838-7858 env GGUACAGGCCAGACAAUUAUU 47
HIV1ID0255 siRNA Gene silencing siRNA antisense "siControl" 21 UACGAAUGACGUGCGGUACGU 5538-5558 sor UACGAAACUGACAGAGGAUAG 47
HIV1ID0256 siRNA Gene silencing siRNA sense "si7658" 21 GGAGAAGUGAAUUAUAUAAAU 7660-7680 env GGAGAAGUGAAUUAUAUAAAU 47
HIV1ID0257 siRNA Gene silencing siRNA antisense "si7658" 21 UUAUAUAAUUCACUUCUCCAA 7658-7678 env UUGGAGAAGUGAAUUAUAUAA 47
HIV1ID0258 siRNA Gene silencing siRNA sense "si7653" 21 CAAUUGGAGAAGUGAAUUAUA 7655-7675 env CAAUUGGAGAAGUGAAUUAUA 47
HIV1ID0259 siRNA Gene silencing siRNA antisense "si7653" 21 UAAUUCACUUCUCCAAUUGUC 7653-7673 env GACAAUUGGAGAAGUGAAUUA 47
HIV1ID0260 siRNA Gene silencing siRNA sense "si4961" 21 GUGAAGGGGCAGUAGUAAUAC 4963-4983 pol GUGAAGGGGCAGUAGUAAUAC 47
HIV1ID0261 siRNA Gene silencing siRNA antisense "si4961" 21 AUUACUACUGCCCCUUCACCU 4961-4981 pol AGGUGAAGGGGCAGUAGUAAU 47
HIV1ID0262 siRNA Gene silencing siRNA sense "si4960" 21 GGUGAAGGGGCAGUAGUAAUA 4962-4982 pol GGUGAAGGGGCAGUAGUAAUA 47
HIV1ID0263 siRNA Gene silencing siRNA antisense "si4960" 21 UUACUACUGCCCCUUCACCUU 4960-4980 pol AAGGUGAAGGGGCAGUAGUAA 47
HIV1ID0264 siRNA Gene silencing siRNA sense "si4888" 21 CAAAAUUUUCGGGUUUAUUAC 4890-4910 pol CAAAAUUUUCGGGUUUAUUAC 47
HIV1ID0265 siRNA Gene silencing siRNA antisense "si4888" 21 AAUAAACCCGAAAAUUUUGAA 4888-4908 pol UUCAAAAUUUUCGGGUUUAUU 47
HIV1ID0266 siRNA Gene silencing siRNA sense "si4840" 21 GCAACAGACAUACAAACUAAA 4842-4862 pol GCAACAGACAUACAAACUAAA 47
HIV1ID0267 siRNA Gene silencing siRNA antisense "si4840" 21 UAGUUUGUAUGUCUGUUGCUA 4840-4860 pol UAGCAACAGACAUACAAACUA 47
HIV1ID0268 siRNA Gene silencing siRNA sense "si4809" 21 CAGUGCAGGGGAAAGAAUAGU 4811-4831 pol CAGUGCAGGGGAAAGAAUAGU 47
HIV1ID0269 siRNA Gene silencing siRNA antisense "si4809" 21 UAUUCUUUCCCCUGCACUGUA 4809-4829 pol UACAGUGCAGGGGAAAGAAUA 47
HIV1ID0270 siRNA Gene silencing siRNA sense "si4806" 21 GUACAGUGCAGGGGAAAGAAU 4808-4828 pol GUACAGUGCAGGGGAAAGAAU 47
HIV1ID0271 siRNA Gene silencing siRNA antisense "si4806" 21 UCUUUCCCCUGCACUGUACCC 4806-4826 pol GGGUACAGUGCAGGGGAAAGA 47
HIV1ID0272 siRNA Gene silencing siRNA sense "si4794" 21 GGGGAUUGGGGGGUACAGUGC 4796-4816 pol GGGGAUUGGGGGGUACAGUGC 47
HIV1ID0273 siRNA Gene silencing siRNA antisense "si4794" 21 ACUGUACCCCCCAAUCCCCCC 4794-4814 pol GGGGGGAUUGGGGGGUACAGU 47
HIV1ID0274 siRNA Gene silencing siRNA sense "si4753" 21 GUACAAAUGGCAGUAUUCAUC 4755-4775 pol GUACAAAUGGCAGUAUUCAUC 47
HIV1ID0275 siRNA Gene silencing siRNA antisense "si4753" 21 UGAAUACUGCCAUUUGUACUG 4753-4773 pol CAGUACAAAUGGCAGUAUUCA 47
HIV1ID0276 siRNA Gene silencing siRNA sense "si4751" 21 CAGUACAAAUGGCAGUAUUCA 4753-4773 pol CAGUACAAAUGGCAGUAUUCA 47
HIV1ID0277 siRNA Gene silencing siRNA antisense "si4751" 21 AAUACUGCCAUUUGUACUGCU 4751-4771 pol AGCAGUACAAAUGGCAGUAUU 47
HIV1ID0278 siRNA Gene silencing siRNA sense "si4750" 21 GCAGUACAAAUGGCAGUAUUC 4752-4772 pol GCAGUACAAAUGGCAGUAUUC 47
HIV1ID0279 siRNA Gene silencing siRNA antisense "si4750" 21 AUACUGCCAUUUGUACUGCUG 4750-4770 pol CAGCAGUACAAAUGGCAGUAU 47
HIV1ID0280 siRNA Gene silencing siRNA sense "si4746" 21 GACAGCAGUACAAAUGGCAGU 4748-4768 pol GACAGCAGUACAAAUGGCAGU 47
HIV1ID0281 siRNA Gene silencing siRNA antisense "si4746" 21 UGCCAUUUGUACUGCUGUCUU 4746-4766 pol AAGACAGCAGUACAAAUGGCA 47
HIV1ID0282 siRNA Gene silencing siRNA sense "si4652" 21 CCUACAAUCCCCAAAGUCAAG 4654-4674 pol CCUACAAUCCCCAAAGUCAAG 47
HIV1ID0283 siRNA Gene silencing siRNA antisense "si4652" 21 UGACUUUGGGGAUUGUAGGGA 4652-4672 pol UCCCUACAAUCCCCAAAGUCA 47
HIV1ID0284 siRNA Gene silencing siRNA sense "si4378" 21 CAUGGACAAGUAGACUGUAGU 4380-4400 pol CAUGGACAAGUAGACUGUAGU 47
HIV1ID0285 siRNA Gene silencing siRNA antisense "si4378" 21 UACAGUCUACUUGUCCAUGCA 4378-4398 pol UGCAUGGACAAGUAGACUGUA 47
HIV1ID0286 siRNA Gene silencing siRNA sense "si4373" 21 CCAUGCAUGGACAAGUAGACU 4375-4395 pol CCAUGCAUGGACAAGUAGACU 47
HIV1ID0287 siRNA Gene silencing siRNA antisense "si4373" 21 UCUACUUGUCCAUGCAUGGCU 4373-4393 pol AGCCAUGCAUGGACAAGUAGA 47
HIV1ID0288 siRNA Gene silencing siRNA sense "si4175" 21 GAGGAAAUGAACAAGUAGAUA 4177-4197 pol GAGGAAAUGAACAAGUAGAUA 47
HIV1ID0289 siRNA Gene silencing siRNA antisense "si4175" 21 UCUACUUGUUCAUUUCCUCCA 4175-4195 pol UGGAGGAAAUGAACAAGUAGA 47
HIV1ID0290 siRNA Gene silencing siRNA sense "si3011" 21 GAUCACCAGCAAUAUUCCAAA 3013-3033 pol GAUCACCAGCAAUAUUCCAAA 47
HIV1ID0291 siRNA Gene silencing siRNA antisense "si3011" 21 UGGAAUAUUGCUGGUGAUCCU 3011-3031 pol AGGAUCACCAGCAAUAUUCCA 47
HIV1ID0292 siRNA Gene silencing siRNA sense "si3006" 21 GAAAGGAUCACCAGCAAUAUU 3008-3028 pol GAAAGGAUCACCAGCAAUAUU 47
HIV1ID0293 siRNA Gene silencing siRNA antisense "si3006" 21 UAUUGCUGGUGAUCCUUUCCA 3006-3026 pol UGGAAAGGAUCACCAGCAAUA 47
HIV1ID0294 siRNA Gene silencing siRNA sense "si3005" 21 GGAAAGGAUCACCAGCAAUAU 3007-3027 pol GGAAAGGAUCACCAGCAAUAU 47
HIV1ID0295 siRNA Gene silencing siRNA antisense "si3005" 21 AUUGCUGGUGAUCCUUUCCAU 3005-3025 pol AUGGAAAGGAUCACCAGCAAU 47
HIV1ID0296 siRNA Gene silencing siRNA sense "si3000" 21 GGGAUGGAAAGGAUCACCAGC 3002-3022 pol GGGAUGGAAAGGAUCACCAGC 47
HIV1ID0297 siRNA Gene silencing siRNA antisense "si3000" 21 UGGUGAUCCUUUCCAUCCCUG 3000-3020 pol CAGGGAUGGAAAGGAUCACCA 47
HIV1ID0298 siRNA Gene silencing siRNA sense "si2486" 21 CUACACCUGUCAACAUAAUUG 2488-2508 pol CUACACCUGUCAACAUAAUUG 47
HIV1ID0299 siRNA Gene silencing siRNA antisense "si2486" 21 AUUAUGUUGACAGGUGUAGGU 2486-2506 pol ACCUACACCUGUCAACAUAAU 47
HIV1ID0300 siRNA Gene silencing siRNA sense "si2485" 21 CCUACACCUGUCAACAUAAUU 2487-2507 pol CCUACACCUGUCAACAUAAUU 47
HIV1ID0301 siRNA Gene silencing siRNA antisense "si2485" 21 UUAUGUUGACAGGUGUAGGUC 2485-2505 pol GACCUACACCUGUCAACAUAA 47
HIV1ID0302 siRNA Gene silencing siRNA sense "si2333" 21 CAGAUGAUACAGUAUUAGAAG 2335-2355 gag CAGAUGAUACAGUAUUAGAAG 47
HIV1ID0303 siRNA Gene silencing siRNA antisense "si2333" 21 UCUAAUACUGUAUCAUCUGCU 2333-2353 gag AGCAGAUGAUACAGUAUUAGA 47
HIV1ID0304 siRNA Gene silencing siRNA sense "si2330" 21 GAGCAGAUGAUACAGUAUUAG 2332-2352 gag GAGCAGAUGAUACAGUAUUAG 47
HIV1ID0305 siRNA Gene silencing siRNA antisense "si2330" 21 AAUACUGUAUCAUCUGCUCCU 2330-2350 gag AGGAGCAGAUGAUACAGUAUU 47
HIV1ID0306 siRNA Gene silencing siRNA sense "si2329" 21 GGAGCAGAUGAUACAGUAUUA 2331-2351 gag GGAGCAGAUGAUACAGUAUUA 47
HIV1ID0307 siRNA Gene silencing siRNA antisense "si2329" 21 AUACUGUAUCAUCUGCUCCUG 2329-2349 gag CAGGAGCAGAUGAUACAGUAU 47
HIV1ID0308 siRNA Gene silencing siRNA sense "si2075" 21 CAGGCUAAUUUUUUAGGGAAG 2077-2097 gag CAGGCUAAUUUUUUAGGGAAG 47
HIV1ID0309 siRNA Gene silencing siRNA antisense "si2075" 21 UCCCUAAAAAAUUAGCCUGUC 2075-2095 gag GACAGGCUAAUUUUUUAGGGA 47
HIV1ID0310 siRNA Gene silencing siRNA sense "si1817" 21 GAAGAAAUGAUGACAGCAUGU 1819-1839 gag GAAGAAAUGAUGACAGCAUGU 47
HIV1ID0311 siRNA Gene silencing siRNA antisense "si1817" 21 AUGCUGUCAUCAUUUCUUCUA 1817-1837 gag UAGAAGAAAUGAUGACAGCAU 47
HIV1ID0312 siRNA Gene silencing siRNA sense "si1490" 21 GACAUAGCAGGAACUACUAGU 1492-1512 gag GACAUAGCAGGAACUACUAGU 47
HIV1ID0313 siRNA Gene silencing siRNA antisense "si1490" 21 UAGUAGUUCCUGCUAUGUCAC 1490-1510 gag GUGACAUAGCAGGAACUACUA 47
HIV1ID0314 siRNA Gene silencing siRNA sense "si770" 21 GAGGCUAGAAGGAGAGAGAUG 772-792 gag GAGGCUAGAAGGAGAGAGAUG 47
HIV1ID0315 siRNA Gene silencing siRNA antisense "si770" 21 UCUCUCUCCUUCUAGCCUCCG 770-790 gag CGGAGGCUAGAAGGAGAGAGA 47
HIV1ID0316 siRNA Gene silencing siRNA sense "si764" 21 CUAGCGGAGGCUAGAAGGAGA 766-786 gag CUAGCGGAGGCUAGAAGGAGA 47
HIV1ID0317 siRNA Gene silencing siRNA antisense "si764" 21 UCCUUCUAGCCUCCGCUAGUC 764-784 gag GACUAGCGGAGGCUAGAAGGA 47
HIV1ID0318 siRNA Gene silencing siRNA sense "si690" 21 CAGGACUCGGCUUGCUGAAGC 692-712 LTR CAGGACUCGGCUUGCUGAAGC 47
HIV1ID0319 siRNA Gene silencing siRNA antisense "si690" 21 UUCAGCAAGCCGAGUCCUGCG 690-710 LTR CGCAGGACUCGGCUUGCUGAA 47
HIV1ID0320 siRNA Gene silencing siRNA sense "si689" 21 GCAGGACUCGGCUUGCUGAAG 691-711 LTR GCAGGACUCGGCUUGCUGAAG 47
HIV1ID0321 siRNA Gene silencing siRNA antisense "si689" 21 UCAGCAAGCCGAGUCCUGCGU 689-709 LTR ACGCAGGACUCGGCUUGCUGA 47
HIV1ID0322 siRNA Gene silencing siRNA sense "si575" 21 GACUCUGGUAACUAGAGAUCC 577-597 5'LTR GACUCUGGUAACUAGAGAUCC 47
HIV1ID0323 siRNA Gene silencing siRNA antisense "si575" 21 AUCUCUAGUUACCAGAGUCAC 575-595 5'LTR GUGACUCUGGUAACUAGAGAU 47
HIV1ID0324 siRNA Gene silencing siRNA sense "si554" 21 GUGUGUGCCCGUCUGUUGUGU 576-596 5'LTR UGACUCUGGUAACUAGAGAUC 47
HIV1ID0325 siRNA Gene silencing siRNA antisense "si554" 21 ACAACAGACGGGCACACACUA 554-574 5'LTR UAGUGUGUGCCCGUCUGUUGU 47
HIV1ID0326 siRNA Gene silencing siRNA sense "si521" 21 CCUCAAUAAAGCUUGCCUUGA 523-543 5'LTR CCUCAAUAAAGCUUGCCUUGA 47
HIV1ID0327 siRNA Gene silencing siRNA antisense "si521" 21 AAGGCAAGCUUUAUUGAGGCU 521-541 5'LTR AGCCUCAAUAAAGCUUGCCUU 47
HIV1ID0328 siRNA Gene silencing siRNA sense "si515" 21 CUUAAGCCUCAAUAAAGCUUG 517-537 5'LTR CUUAAGCCUCAAUAAAGCUUG 47
HIV1ID0329 siRNA Gene silencing siRNA antisense "si515" 21 AGCUUUAUUGAGGCUUAAGCA 515-535 5'LTR UGCUUAAGCCUCAAUAAAGCU 47
HIV1ID0330 siRNA Gene silencing siRNA sense "si512" 21 CUGCUUAAGCCUCAAUAAAGC 514-534 5'LTR CUGCUUAAGCCUCAAUAAAGC 47
HIV1ID0331 siRNA Gene silencing siRNA antisense "si512" 21 UUUAUUGAGGCUUAAGCAGUG 512-532 5'LTR CACUGCUUAAGCCUCAAUAAA 47
HIV1ID0332 siRNA Gene silencing siRNA sense "si510" 21 CACUGCUUAAGCCUCAAUAAA 512-532 5'LTR CACUGCUUAAGCCUCAAUAAA 47
HIV1ID0333 siRNA Gene silencing siRNA antisense "si510" 21 UAUUGAGGCUUAAGCAGUGGG 510-530 5'LTR CCCACUGCUUAAGCCUCAAUA 47
HIV1ID0334 siRNA Gene silencing siRNA sense "si509" 21 CCACUGCUUAAGCCUCAAUAA 511-531 5'LTR CCACUGCUUAAGCCUCAAUAA 47
HIV1ID0335 siRNA Gene silencing siRNA antisense "si509" 21 AUUGAGGCUUAAGCAGUGGGU 509-529 5'LTR ACCCACUGCUUAAGCCUCAAU 47
HIV1ID0336 siRNA Gene silencing siRNA sense sequence "TAR" 21 AGACCAGATCTGAGCCTGGTT 468-488 5'LTR AGACCAGAUCUGAGCCUGGGA 48
HIV1ID0337 siRNA Gene silencing siRNA sense sequence "Tat(SF2)" 21 CTGCTTGTAACAATTGCTATT 5889-5909 tat CUGCUUGUACCAAUUGCUAUU 48
HIV1ID0338 shRNA Gene silencing shRNA sequence "vif" 49 GTTCAGAAGTACACATCCCTTCAAGAGAGG(...) 5193-5213 sor AAGUUCAGAAGUACACAUCCC 49
HIV1ID0339 shRNA Gene silencing shRNA sequence "gag" 49 GATTGTACTGAGAGACAGGTTCAAGAGACC(...) 2060-2080 gag AAGAUUGUACUGAGAGACAGG 49
HIV1ID0340 shRNA Gene silencing shRNA sequence "rev" 49 GGCACTTATCTGGGACGATTTCAAGAGAAT(...) 8483-8501 env GGCACUUAUCUGGGACGAU 49
HIV1ID0341 shRNA Gene silencing shRNA sequence "Nef" 49 GTGCCTGGCTAGAAGCACATTCAAGAGATG(...) 8960-8978 27k protein GUGCCUGGCUAGAAGCACA 50
HIV1ID0342 shRNA Gene silencing shRNA sequence "UTR-B" 49 GGCTAGAAGGAGAGAGATGTTCAAGAGACA(...) 774-792 LTR GGCUAGAAGGAGAGAGAUG 50
HIV1ID0343 shRNA Gene silencing shRNA sequence "UTR-A" 49 GCGGAGGCTAGAAGGAGAGTTCAAGAGACT(...) 769-787 LTR GCGGAGGCUAGAAGGAGAG 50
HIV1ID0344 shRNA Gene silencing shRNA sequence "TatRev-B" 49 CCTATGGCAGGAAGAAGCGTTCAAGAGACG(...) 5967-6016 tat CCUAUGGCAGGAAGAAGCGGAGACAGCGAC(...) 50
HIV1ID0345 shRNA Gene silencing shRNA sequence "TatRev-A" 49 GCCTTAGGCATCTCCTATGTTCAAGAGACA(...) 5954-5972 tat GCCUUAGGCAUCUCCUAUG 50
HIV1ID0346 shRNA Gene silencing shRNA sequence "PPT" 49 GGGGGGACTGGAAGGGCTATTCAAGAGATA(...) 9078-9096 27k protein GGGGGGACUGGAAGGGCUA 50
HIV1ID0347 shRNA Gene silencing shRNA sequence "PBS-B" 51 TGGCGCCCGAACAGGGACTTTTCAAGAGAA(...) 636-653 LTR UGGCGCCCGAACAGGGAC 50
HIV1ID0348 shRNA Gene silencing shRNA sequence "shRNA-1" 53 GTGGCGCCCGAACAGGGACTTTTCAAGAGA(...) 635-653 LTR GUGGCGCCCGAACAGGGAC 50
HIV1ID0349 siRNA Gene silencing siRNA sense sequence "M441" 21 CTTGGCACTAACAGCATTATT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 51
HIV1ID0350 siRNA Gene silencing siRNA antisense sequence "M441" 21 TAATGCTGTTAGTGCCAAGTT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 51
HIV1ID0351 siRNA Gene silencing siRNA sense sequence "M98" 20 GAAAGCTAGGGGATGGTTTT 5139-5158 sor GAAAGCUAGGGGAUGGUUUU 51
HIV1ID0352 siRNA Gene silencing siRNA antisense sequence "M98" 20 AACCATCCCCTAGCTTTCTT 5139-5158 sor GAAAGCUAGGGGAUGGUUUU 51
HIV1ID0353 siRNA Gene silencing siRNA sense sequence "MTAR" 21 AGACCAGATATGAGCCTGGTT 9553-9573 3'LTR AGACCAGAUCUGAGCCUGGGA 51
HIV1ID0354 siRNA Gene silencing siRNA antisense sequence "MTAR" 21 CCAGGCTCATATCTGGTCTTT 9551-9571 3'LTR UUAGACCAGAUCUGAGCCUGG 51
HIV1ID0355 siRNA Gene silencing siRNA sense sequence "TAR" 21 AGACCAGATCTGAGCCTGGTT 9553-9573 3'LTR AGACCAGAUCUGAGCCUGGGA 51
HIV1ID0356 siRNA Gene silencing siRNA antisense sequence "TAR" 21 CCAGGCTCAGATCTGGTCTTT 9551-9571 3'LTR UUAGACCAGAUCUGAGCCUGG 51
HIV1ID0357 siRNA Gene silencing siRNA sense sequence "nef" 21 GTGCCTGGCTAGAAGCACATT 8960-8980 27k protein GUGCCUGGCUAGAAGCACAAG 51
HIV1ID0358 siRNA Gene silencing siRNA antisense sequence "nef" 21 TGTGCTTCTAGCCAGGCACTT 8968-8988 27k protein CUAGAAGCACAAGAGGAGGAG 51
HIV1ID0359 siRNA Gene silencing siRNA sense sequence "M388" 21 GACTTCAAGGGAGATGGCATT 2916-2936 pol GACUUCAGGAAGUAUACUGCA 51
HIV1ID0360 siRNA Gene silencing siRNA antisense sequence "M388" 21 TGCCATCTCCCTTGAAGTCTT 5050-5070 pol AGAUGGCAGGUGAUGAUUGUG 51
HIV1ID0361 siRNA Gene silencing siRNA sense sequence "G388" 21 GACTTCAAGGAAGATGGCATT 2916-2936 pol GACUUCAGGAAGUAUACUGCA 51
HIV1ID0362 siRNA Gene silencing siRNA antisense sequence "G388" 21 TGCCATCTTCCTTGAAGTCTT 5050-5070 pol AGAUGGCAGGUGAUGAUUGUG 51
HIV1ID0363 siRNA Gene silencing siRNA sense sequence "T441" 21 CTTGGCACTAGCAGCATTATT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 51
HIV1ID0364 siRNA Gene silencing siRNA antisense sequence "T441" 21 TAATGCTGCTAGTGCCAAGTT 5479-5499 sor UACUUGGCACUAGCAGCAUUA 51
HIV1ID0365 siRNA Gene silencing siRNA sense sequence "T283" 21 AGCACACAAGTAGACCCTGTT 5323-5343 sor AGCACACAAGUAGACCCUGAA 51
HIV1ID0366 siRNA Gene silencing siRNA antisense sequence "T283" 21 CAGGGTCTACTTGTGTGCTTT 5321-5341 sor AUAGCACACAAGUAGACCCUG 51
HIV1ID0367 siRNA Gene silencing siRNA sense sequence "T98" 21 GGAAAGCTAAGGACTGGTTTT 5138-5158 sor GGAAAGCUAGGGGAUGGUUUU 51
HIV1ID0368 siRNA Gene silencing siRNA antisense sequence "T98" 21 AACCAGTCCTTAGCTTTCCTT 3470-3490 pol AGAGAUUCUAAAAGAACCAGU 51
HIV1ID0369 siRNA Gene silencing siRNA sense sequence "RT2" 21 TGAGACACCAGGGATTAGATT 2960-2980 pol UGAGACACCAGGGAUUAGAUA 52
HIV1ID0370 siRNA Gene silencing siRNA antisense sequence "RT2" 21 TCTAATCCCTGGTGTCTCATT 2958-2978 pol AAUGAGACACCAGGGAUUAGA 52
HIV1ID0371 siRNA Gene silencing siRNA sense sequence "RT1" 21 GAGACACCAGGGATTAGATTT 2961-2981 pol GAGACACCAGGGAUUAGAUAU 52
HIV1ID0372 siRNA Gene silencing siRNA antisense sequence "RT1" 21 ATCTAATCCCTGGTGTCTCTT 2959-2979 pol AUGAGACACCAGGGAUUAGAU 52
HIV1ID0373 siRNA Gene silencing siRNA sense sequence "tat3" 21 GAAGCGGAGACAGCGACGATT 5980-6000 tat GAAGCGGAGACAGCGACGAAG 52
HIV1ID0374 siRNA Gene silencing siRNA antisense sequence "tat3" 21 TCGTCGCTGTCTCCGCTTCTT 5978-5998 tat AAGAAGCGGAGACAGCGACGA 52
HIV1ID0375 siRNA Gene silencing siRNA sense sequence "tat2" 21 CTAGAGCCCTGGAAGCATCTT 5852-5872 tat CUAGAGCCCUGGAAGCAUCCA 52
HIV1ID0376 siRNA Gene silencing siRNA antisense sequence "tat2" 21 GATGCTTCCAGGGCTCTAGTT 5850-5870 tat GACUAGAGCCCUGGAAGCAUC 52
HIV1ID0377 siRNA Gene silencing siRNA sense sequence "tat1" 21 TATGGCAGGAAGAAGCGGATT 5969-5989 tat UAUGGCAGGAAGAAGCGGAGA 52
HIV1ID0378 siRNA Gene silencing siRNA antisense sequence "tat1" 21 TCCGCTTCTTCCTGCCATATT 5967-5987 tat CCUAUGGCAGGAAGAAGCGGA 52
HIV1ID0379 siRNA Gene silencing shRNA sequence "Tat" 49 TATGGCAGGAAGAAGCGGATTCAAGAGATC(...) 5969-5987 tat UAUGGCAGGAAGAAGCGGA 53
HIV1ID0380 siRNA Gene expression siRNA sense sequence "p24" 21 GATTGTACTGAGAGACAGGCT 2062-2082 gag GAUUGUACUGAGAGACAGGCU 54