Database reference: HIV1ID0379

Virus: HIV-1

Type of target: siRNA

Techniques: Gene silencing

Target: shRNA sequence

Status:

Original name: "Tat"

Target length: 49

Amplicon length:

Sequence (5'-3'): TATGGCAGGAAGAAGCGGATTCAAGAGATCCGCTTCTTCCTGCCATATT

Position in reference genome: 5969-5987

Genomic region: tat

Related image:

Related publications:
Specific inhibition of HIV-1 replication by short hairpin RNAs targeting human cyclin T1 without inducing apoptosis. Li Z, Xiong Y, Peng Y, Pan J, Chen Y, Wu X, Hussain S, Tien P, Guo D.