Database reference: HIV1ID0180

Virus: HIV-1

Type of target: Primer

Techniques: Nested PCR

Target: Primer reverse

Status: Published

Original name: HPOL4538

Target length: 22

Amplicon length:

Sequence (5'-3'): TACTGCCCCTTCACCTTTCCA

Position in reference genome: 4956-4976

Genomic region: pol

Related image:

Related publications:
Fransen, Katrien, et al. "Design and evaluation of new, highly sensitive and specific primers for polymerase chain reaction detection of HIV-1 infected primary lymphocytes."�Molecular and cellular probes�8.4 (1994): 317-322.