Database reference: HIV1ID0163

Virus: HIV-1

Type of target: Primer pair

Techniques: PCR

Target: Primer forward

Status: Published

Original name: intF

Target length: 20

Amplicon length: 425

Sequence (5'-3'): CCCTACAATCCCCAAAGTCA

Position in reference genome: 4653-4672

Genomic region: pol

Related image:

Related publications:
Wang, Jung-Hao, et al. "An integrated chip capable of performing sample pretreatment and nucleic acid amplification for HIV-1 detection."´┐ŻBiosensors and Bioelectronics´┐Ż41 (2013): 484-491.