Database reference: HIV1ID0065

Virus: HIV-1

Type of target: Primer

Techniques: Recombinase Polymerase Amplification

Target: Primer forward

Status: Published

Original name: pol F2

Target length: 33

Amplicon length:

Sequence (5'-3'): CCCAAAGTCAAGGAGTAGTAGAATCTATGAATA

Position in reference genome: 4663-4695

Genomic region: pol

Related image:

Related publications:
Boyle, David S., et al. "Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification". mBio