Database reference: HIV1ID0023
Virus: HIV-1
Type of target: Probe
Techniques: Multiplex real-time PCR & Taqman probes
Target: Probe (Taqman)
Status: Published
Original name: LTR-P
Target length: 26
Amplicon length:
Sequence (5'-3'): AGTAGTGTGTGCCCGTCTGTTGTGTG
Position in reference genome:
Genomic region: 5'LTR
Related image:
Related publications:
Candotti, Daniel, et al. "Multiplex real-time quantitative RT-PCR assay for hepatitis B virus, hepatitis C virus, and human immunodeficiency virus type 1." Journal of virological methods 118.1 (2004): 39-47.