Database reference: HIV1ID0020
Virus: HIV-1
Type of target: Probe
Techniques: Multiplex real-time PCR & molecular beacons
Target: Probe (molecular beacons)
Status: Published
Original name:
Target length: 45
Amplicon length:
Sequence (5'-3'): GCGAGCCTGGGATTAAATAAAATAGTAAGAATGTATAGCGCTCGC
Position in reference genome:
Genomic region: gag
Related image:
Related publications:
Vet, Jacqueline AM, et al. "Multiplex detection of four pathogenic retroviruses using molecular beacons." Proceedings of the National Academy of Sciences 96.11 (1999): 6394-6399. // Sanders-Buell, Eric, Mika O. Salminen, and Francine E. McCutchan. "Sequencing primers for HIV-1." Human retroviruses and AIDS (1995): 15-21.