Database reference: HIV1ID0005
Virus: HIV-1
Type of target: PCR primer pair
Techniques: SYBR Green real time PCR
Target: PCR primer reverse
Status: Published
Original name: SK431
Target length: 27
Amplicon length: 142
Sequence (5'-3'): TGCTATGTCAGTTCCCCTTGGTTCTCT
Position in reference genome: 1474-1500 | Genomic region: gag
Related image: Related publications: Mulder, J., et al. "Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection." Journal of clinical microbiology 32.2 (1994): 292-300.Christopherson, Cindy, John Sninsky, and Shirley Kwok. "The effects of internal primer-template mismatches on RT-PCR: HIV-1 model studies." Nucleic acids research 25.3 (1997): 654-658.Gibellini, D., Gardini, F., Vitone, F., Schiavone, P., Furlini, G., & Carla Re, M. (2006). Simultaneous detection of HCV and HIV-1 by SYBR Green real time multiplex RT-PCR technique in plasma samples. Molecular and cellular probes, 20(3), 223-229.G. Gibellini, F. Vitone, E. Gori, M. La Placa, M.C. Re Quantitative detection of human immunodeficiency virus type 1 (HIV-1) viral load by SYBR Green real-time RT-PCR technique in HIV-1 seropositive patients J Virol Methods, 115 (2004), pp. 183�189
De Crignis, Elisa, et al. "HIV-1 and HCV detection in dried blood spots by SYBR Green multiplex real-time RT-PCR." Journal of virological methods 165.1 (2010): 51-56.Defoort, J-P., et al. "Simultaneous detection of multiplex-amplified human immunodeficiency virus type 1 RNA, hepatitis C virus RNA, and hepatitis B virus DNA using a flow cytometer microsphere-based hybridization assay." Journal of clinical microbiology 38.3 (2000): 1066-1071.