Search for the best oligonucleotides according to the degree of conservation in specific sequence alignments


The table describes for each oligonucleotide different measures of sequence conservation for all sequence alignments used the database:
-PIS: percentage of identical sites
-3'PIS: percentage of identical sites in the last five nucleotides at the 3' end of oligonucleotide
-PPI: percentage of pairwise identity
-POS: Position in alignment.

HIVoligoDB_alig01
Database reference Techniques Target Original name Target length Amplicon length Sequence (5'-3') Position in reference genome Genomic region Sequence in reference genome POS Number of sequences in Alig01 PIS 3'PIS PPI Score Related publications
Database reference Techniques Target Original name Target length Amplicon length Sequence (5'-3') Position in reference genome Genomic region Sequence in reference genome POS Number of sequences in Alig01 PIS 3'PIS PPI Score Related publications
HIV1ID0001 Nested PCR PCR primer forward A1352 23 95 GRAACCCACTGCTTAASSCTCAA 506-528 5'LTR GGAACCCACUGCUUAAGCCUCAA 637-644 43 0.00 0.00 92.25 30.75 1
HIV1ID0002 Nested PCR PCR primer reverse A1355 23 GAGGGATCTCTAGNYACCAGAGT 578-600 5'LTR ACUCUGGUAACUAGAGAUCCCUC 725-747 61 52.17 20.00 97.29 56.49 1
HIV1ID0003 Nested PCR PCR primer forward A1354 21 125 CTCAATAAAGCTTGCCTTGAG 524-544 5'LTR CUCAAUAAAGCUUGCCUUGAG 648-670 49 0.00 0.00 93.93 31.31 1
HIV1ID0004 Nested PCR PCR primer reverse A1353 23 TGTTCGGGCGCCACTGCTAGAGA 626-648 5'LTR UCUCUAGCAGUGGCGCCCGAACA 787-803 80 0.00 0.00 96.53 32.18 1
HIV1ID0005 SYBR Green real time PCR PCR primer reverse SK431 27 142 TGCTATGTCAGTTCCCCTTGGTTCTCT 1474-1500 gag AGAGAACCAAGGGGAAGUGACAUAGCA 1849-1875 170 51.85 80.00 93.29 75.05 2; 3; 4; 5; 6; 7;
HIV1ID0006 SYBR Green real time PCR PCR primer forward SK462 30 AGTTGGAGGACATCAAGCAGCCATGCAAAT 1359-1388 gag AGUGGGGGGACAUCAAGCAGCCAUGCAAAU 1734-1763 170 56.67 60.00 92.45 69.71 2; 3; 4; 5; 6; 7;
HIV1ID0007 PCR Probe SK102 33 GAGACCATCAATGAGGAAGCTGCAGAATGG(...) 1396-1428 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 1771-1803 170 54.55 80.00 92.04 75.53 2; 3; 7;
HIV1ID0008 PCR Probe CO3 40 TGAGTTGCAACAGATGCTGTTGCGCCTCAA(...) 7890-7929 env CUGAGGGCUAUUGAGGCGCAACAGCAUCUG(...) 8954-8993 170 30.00 40.00 89.17 53.06 8
HIV1ID0009 Multiplex-RT PCR & ELISA PCR primer forward F2 23 189 CAGAAGGAGCCACCCCACAAGAT 1316-1338 gag CAGAAGGAGCCACCCCACAAGAU 1691-1713 170 43.48 40.00 93.97 59.15 9
HIV1ID0010 Multiplex-RT PCR & ELISA PCR primer reverse R2 25 TTCCTGCTATGTCACTTCCCCTTGG 1480-1504 gag CCAAGGGGAAGUGACAUAGCAGGAA 1855-1879 170 48.00 60.00 94.30 67.43 10
HIV1ID0011 Multiplex-RT PCR & ELISA Probe ziv 22 CTTGGTTCTCTCATYTGGCCTG 1463-1484 gag CAGGCCAGAUGAGAGAACCAAG 1838-1859 170 54.55 60.00 90.96 68.50 11
HIV1ID0012 Multiplex real-time PCR & mole(...) PCR primer forward 18 151 GTACAGTGCAGGGGAAAG 4808-4825 pol GUACAGUGCAGGGGAAAG 5399-5416 170 44.44 80.00 96.47 73.64 12
HIV1ID0013 Multiplex real-time PCR & mole(...) PCR primer reverse 20 CCAGAGTAGTTTTGCTGGTC 4939-4958 pol GACCAGCAAAGCUCCUCUGG 5530-5549 170 55.00 80.00 92.00 75.67 12
HIV1ID0014 Multiplex real-time PCR & mole(...) Probe (molecular beacons) 32 CCCGTGGTTTATTACAGGGACAGCAGAACG(...) 4901-4923 pol GGUUUAUUACAGGGACAGCAGAA 5492-5514 170 52.17 60.00 96.67 69.61 12
HIV1ID0015 Multiplex-RT PCR & ELISA PCR primer forward SK100 19 291 ATCAAGCAGCCATGCAAAT 1370-1388 gag AUCAAGCAGCCAUGCAAAU 1745-1763 170 63.16 60.00 91.33 71.50 13
HIV1ID0016 Multiplex-RT PCR & ELISA PCR primer reverse SK104 22 CTTTTGGTCCTTGTCTTATGTC 1639-1660 gag GACAUAAGACAAGGACCAAAGG 2026-2047 170 54.55 40.00 91.37 61.97 13
HIV1ID0017 Multiplex-RT PCR & ELISA Probe H-1 probe 23 AATGAGGAGGCTGCAGAATGGGA 1405-1427 gag AAUGAGGAAGCUGCAGAAUGGGA 1780-1802 170 56.52 80.00 95.20 77.24 13
HIV1ID0018 Multiplex real-time PCR & mole(...) PCR primer forward SK 38, gagF 28 115 ATAATCCACCTATCCCAGTAGGAGAAAT 1544-1571 gag AUAAUCCACCUAUCCCAGUAGGAGAAAU 1928-1958 170 25.81 40.00 86.44 50.75 14; 15; 19; 8;
HIV1ID0019 Multiplex real-time PCR & mole(...) PCR primer reverse gagR 27 TTTGGTCCTTGTCTTATGTCCAGAATG 1632-1658 gag CAUUCUGGACAUAAGACAAGGACCAAA 2019-2045 170 44.44 20.00 92.12 52.19 14; 19;
HIV1ID0020 Multiplex real-time PCR & mole(...) Probe (molecular beacons) 45 GCGAGCCTGGGATTAAATAAAATAGTAAGA(...) 1591-1623 gag CUGGGAUUAAAUAAAAUAGUAAGAAUGUAU(...) 1978-2010 170 45.45 60.00 94.26 66.57 14
HIV1ID0021 Multiplex real-time PCR & Taqm(...) PCR primer forward LTR-F 20 76 TAAAGCTTGCCTTGAGTGCT 529-548 5'LTR UAAAGCUUGCCUUGAGUGCU 660-671 49 0.00 0.00 91.92 30.64 16
HIV1ID0022 Multiplex real-time PCR & Taqm(...) PCR primer reverse LTR-R2 24 GTCTGAGGGATCTCTAGTTACCAG 581-604 5'LTR CUGGUAACUAGAGAUCCCUCAGAC 728-751 61 54.17 40.00 97.12 63.76 16
HIV1ID0023 Multiplex real-time PCR & Taqm(...) Probe (Taqman) LTR-P 26 AGTAGTGTGTGCCCGTCTGTTGTGTG 552-577 5'LTR AGUAGUGUGUGCCCGUCUGUUGUGUG 684-709 61 0.00 0.00 93.09 31.03 16
HIV1ID0024 Nested PCR PCR primer forward WOI1 25 333 GAGAGATGGGTGCGAGAGCGTCAGT 785-809 gag GAGAGAUGGGUGCGAGAGCGUCAGU 1083-1107 168 8.00 20.00 95.88 41.29 17
HIV1ID0025 Nested PCR PCR primer reverse WOI2 25 TGTTTTGCTCTTCCTCTATCTTGTC 1093-1117 gag GACAAGAUAGAGGAAGAGCAAAACA 1391-1415 170 4.00 0.00 78.69 27.56 17
HIV1ID0026 Nested PCR PCR primer forward WII1-2 18 TGCGAGAGCGTCAGTATT 795-812 gag UGCGAGAGCGUCAGUAUU 1093-1110 168 11.11 0.00 95.00 35.37 17
HIV1ID0027 Nested PCR PCR primer reverse WII2 19 AGGGTTGCTACTGTATTAT 1025-1043 gag AUAAUACAGUAGCAACCCU 1323-1341 170 15.79 40.00 84.07 46.62 17
HIV1ID0028 multiplex real-time PCR & olig(...) PCR primer reverse HIV_OUT_F 26 284 AGAACCGRTCTACATARTCTCTAARG 1665-1690 gag CUUUAGAGACUAUGUAGACCGGUUCU 2052-2077 170 26.92 20.00 90.05 45.66 18
HIV1ID0029 multiplex real-time PCR & olig(...) PCR primer forward HIV_OUT_R 21 TGAGGARGCTGCAGAATGGGA 1407-1427 gag UGAGGAAGCUGCAGAAUGGGA 1782-1802 170 52.38 80.00 94.75 75.71 18
HIV1ID0030 multiplex real-time PCR & olig(...) PCR primer reverse HIV_IN_F_I 25 181 TGGYCCTTGTYTTATGTCCARAATG 1632-1665 gag CAUUCUGGACAUAAGACAAGGACCAAAGGA(...) 2019-2052 170 44.12 20.00 91.30 51.81 18
HIV1ID0031 multiplex real-time PCR & olig(...) PCR primer forward HIV_IN_R 23 AGAACCAAGGGGAAGTGACATAG 1476-1498 gag AGAACCAAGGGGAAGUGACAUAG 1851-1873 170 52.17 20.00 93.07 55.08 18
HIV1ID0032 SYBR Green real time PCR PCR primer forward NP51 26 228 GCAGCATAGAACAAAAATAGAGGAGC 3137-3162 pol GCAGCAUAGAACAAAAAUAGAGGAGC 3716-3741 170 19.23 20.00 85.54 41.59 19
HIV1ID0033 SYBR Green real time PCR PCR primer reverse NP52 24 GGGTAAATCTGACTTGCCCAATTC 3341-3364 pol GAAUUGGGCAAGUCAGAUUUACCC 3921-3944 170 20.83 40.00 90.26 50.36 19
HIV1ID0034 SYBR Green real time PCR PCR primer forward NP170 26 132 GARACCAARAATGATAGGRGGAATTG 2378-2403 pol GAAACCAAAAAUGAUAGGGGGAAUUG 2954-2979 170 26.92 20.00 96.97 47.97 19
HIV1ID0035 SYBR Green real time PCR PCR primer reverse NP171 23 CCAATTATGTTGACAGGKGTRGG 2487-2509 pol CCUACACCUGUCAACAUAAUUGG 3063-3088 170 34.62 80.00 95.25 69.96 19
HIV1ID0036 SYBR Green real time PCR PCR primer forward NP175 25 159 GRGAAAGAATARTAGACATAATAGC 4819-4843 pol GGGAAAGAAUAGUAGACAUAAUAGC 5410-5434 170 44.00 40.00 95.47 59.82 19
HIV1ID0037 SYBR Green real time PCR PCR primer reverse NP174 21 CTACYGCCCCTTYACCTTTCC 4957-4977 pol GGAAAGGUGAAGGGGCAGUAG 5548-5568 170 66.67 80.00 98.70 81.79 19
HIV1ID0038 PCR PCR primer forward SK 29 18 105 ACTAGGGAACCCACTGCT 501-518 5'LTR ACUAGGGAACCCACUGCU 625-639 42 13.33 40.00 94.55 49.30 8
HIV1ID0039 PCR PCR primer reverse SK 30 17 GGTCTGAGGGATCTCTA 589-605 5'LTR UAGAGAUCCCUCAGACC 736-752 61 52.94 40.00 97.53 63.49 8
HIV1ID0040 PCR Probe SK 31 34 ACCAGAGTCACACAACAGACGGGCACACAC(...) 552-585 5'LTR AGUAGUGUGUGCCCGUCUGUUGUGUGACUC(...) 684-709 61 0.00 0.00 93.09 31.03 8
HIV1ID0041 PCR PCR primer forward SK 68 20 142 AGCAGCAGGAAGCACTATGG 7796-7815 env AGCAGCAGGAAGCACUAUGG 8860-8879 170 25.00 40.00 96.74 53.91 8
HIV1ID0042 PCR PCR primer reverse SK 69 21 CCAGACTGTGAGTTGCAACAG 7917-7937 env CUGUUGCAACUCACAGUCUGG 8981-9001 170 19.05 0.00 90.23 36.42 8
HIV1ID0043 PCR Probe SK 70 35 ACGGTACAGGCCAGACAATTATTGTCTGGT(...) 7836-7870 env ACGGUACAGGCCAGACAAUUAUUGUCUGGU(...) 8900-8934 170 34.29 60.00 93.56 62.62 8
HIV1ID0044 PCR PCR primer forward CO1 20 135 ACAATTATTGTCTGGTATAG 7850-7869 env ACAAUUAUUGUCUGGUAUAG 8914-8933 170 30.00 60.00 91.07 60.36 8
HIV1ID0045 PCR PCR primer reverse CO2 20 AGGTATCTTTCCACAGCCAG 7965-7984 env CUGGCUGUGGAAAGAUACCU 9029-9048 170 15.00 20.00 92.21 42.40 8
HIV1ID0046 Recombinase Polymerase Amplifi(...) Primer forward gag F1 32 TCACCTAGAACTTTAAATGCATGGGTAAAA(...) 1231-1262 gag UCACCUAGAACUUUAAAUGCAUGGGUAAAA(...) 1606-1637 170 34.38 60.00 91.98 62.12 20
HIV1ID0047 Recombinase Polymerase Amplifi(...) Primer forward gag F2 32 AATGCATGGGTAAAAGTAGTAGAAGAGAAG(...) 1246-1277 gag AAUGCAUGGGUAAAAGUAGUAGAAGAGAAG(...) 1621-1652 170 37.50 20.00 90.35 49.28 20
HIV1ID0048 Recombinase Polymerase Amplifi(...) Primer forward gag F3 32 AAGGCTTTCAGCCCAGAAGTGATACCCATG(...) 1273-1304 gag AAGGCUUUCAGCCCAGAAGUGAUACCCAUG(...) 1648-1679 170 34.38 40.00 92.58 55.65 20
HIV1ID0049 Recombinase Polymerase Amplifi(...) Primer reverse gag R1 32 TATTTGTTCCTGAAGGGTACTAGTAGTTCC(...) 1499-1530 gag CAGGAACUACUAGUACCCUUCAGGAACAAA(...) 1874-1905 170 31.25 40.00 92.68 54.64 20
HIV1ID0050 Recombinase Polymerase Amplifi(...) Primer reverse gag R2 32 TACTAGTAGTTCCTGCTATGTCACTTCCCC(...) 1482-1513 gag AAGGGGAAGUGACAUAGCAGGAACUACUAG(...) 1857-1888 170 40.62 40.00 94.15 58.26 20
HIV1ID0051 Recombinase Polymerase Amplifi(...) Primer reverse gag R3 32 CCTGCTATGTCACTTCCCCTTGGTTCTCTC(...) 1471-1502 gag AUGAGAGAACCAAGGGGAAGUGACAUAGCA(...) 1846-1877 170 46.88 40.00 92.72 59.87 20
HIV1ID0052 Recombinase Polymerase Amplifi(...) Primer reverse gag R4 32 TTGATGGTCTCTTTTAACATTTGCATGGCT(...) 1375-1406 gag GCAGCCAUGCAAAUGUUAAAAGAGACCAUC(...) 1750-1781 170 56.25 80.00 92.30 76.18 20
HIV1ID0053 Recombinase Polymerase Amplifi(...) Primer reverse gag R44 32 CCCATTCTGCAGCTTCCTCATTGATGGTCT(...) 1396-1426 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 1771-1801 170 54.84 80.00 93.15 76.00 20
HIV1ID0054 Recombinase Polymerase Amplifi(...) Primer reverse gag R45 32 TCATTGATGGTCTCTTTTAACATTTGCATG(...) 1378-1409 gag GCCAUGCAAAUGUUAAAAGAGACCAUCAAU(...) 1753-1784 170 56.25 60.00 92.30 69.52 20
HIV1ID0055 Recombinase Polymerase Amplifi(...) Primer forward LTR F2 33 CATATAAGCAGCTGCTTTTTGCCTGTACTG(...) 425-457 LTR CAUAUAAGCAGCUGCUUUUUGCCUGUACUG(...) 540-572 35 6.06 40.00 90.67 45.58 20
HIV1ID0056 Recombinase Polymerase Amplifi(...) Primer forward LTR F3 31 CCTGTACTGGGTCTCTCTGGTTAGACCAGA(...) 446-476 LTR CCUGUACUGGGUCUCUCUGGUUAGACCAGA(...) 561-593 36 12.12 60.00 90.71 54.28 20
HIV1ID0057 Recombinase Polymerase Amplifi(...) Primer forward LTR F4 34 CTGGGTCTCTCTGGTTAGACCAGATTTGAG(...) 452-485 LTR CUGGGUCUCUCUGGUUAGACCAGAUCUGAG(...) 567-602 39 0.00 0.00 89.69 29.90 20
HIV1ID0058 Recombinase Polymerase Amplifi(...) Primer forward LTR F5 33 TTAGACCAGATTTGAGCCTGGGAGCTCTCT(...) 466-498 LTR UUAGACCAGAUCUGAGCCUGGGAGCUCUCU(...) 586-615 40 13.33 40.00 92.99 48.77 20
HIV1ID0059 Recombinase Polymerase Amplifi(...) Primer forward LTR F6 32 CCTGGGAGCTCTCTGGCTAACTAGGGAACC(...) 482-513 LTR CCUGGGAGCUCUCUGGCUAACUAGGGAACC(...) 599-634 40 30.56 100.00 89.96 73.51 20
HIV1ID0060 Recombinase Polymerase Amplifi(...) Primer reverse LTR R1 30 CCCTGTTCGGGCGCCACTGCTAGAGATTTT 622-651 LTR AAAAUCUCUAGCAGUGGCGCCCGAACAGGG 787-806 80 5.00 0.00 96.85 33.95 20
HIV1ID0061 Recombinase Polymerase Amplifi(...) Primer reverse LTR R2 33 TCTGAGGGATCTCTAGTTACCAGAGTCACA(...) 571-603 LTR UUGUGUGACUCUGGUAACUAGAGAUCCCUC(...) 725-750 61 53.85 20.00 97.48 57.11 20
HIV1ID0062 Recombinase Polymerase Amplifi(...) Primer reverse LTR R3 32 ATCTCTAGTTACCAGAGTCACACAACAGAC(...) 564-595 LTR CCGUCUGUUGUGUGACUCUGGUAACUAGAG(...) 725-742 61 44.44 20.00 96.88 53.77 20
HIV1ID0063 Recombinase Polymerase Amplifi(...) Primer reverse LTR R4 32 CCAGAGTCACACAACAGACGGGCACACACT(...) 553-584 LTR GUAGUGUGUGCCCGUCUGUUGUGUGACUCU(...) 684-709 61 0.00 0.00 93.09 31.03 20
HIV1ID0064 Recombinase Polymerase Amplifi(...) Primer forward pol F1 33 CCCTACAATCCCCAAAGTCAAGGAGTAGTA(...) 4653-4685 pol CCCUACAAUCCCCAAAGUCAAGGAGUAGUA(...) 5243-5275 170 48.48 20.00 94.88 54.45 20
HIV1ID0065 Recombinase Polymerase Amplifi(...) Primer forward pol F2 33 CCCAAAGTCAAGGAGTAGTAGAATCTATGA(...) 4663-4695 pol CCCAAAGUCAAGGAGUAGUAGAAUCUAUGA(...) 5253-5285 170 45.45 60.00 94.04 66.50 20
HIV1ID0066 Recombinase Polymerase Amplifi(...) Primer forward pol F3 34 TAGTAGAATCTATGAATAAAGAATTAAAGA(...) 4678-4711 pol UAGUAGAAUCUAUGAAUAAAGAAUUAAAGA(...) 5268-5301 170 17.65 0.00 92.85 36.83 20
HIV1ID0067 Recombinase Polymerase Amplifi(...) Primer forward pol F4 33 ACAGCAGTACAAATGGCAGTATTCATCCAC(...) 4749-4781 pol ACAGCAGUACAAAUGGCAGUAUUCAUCCAC(...) 5339-5371 170 39.39 60.00 96.16 65.18 20
HIV1ID0068 Recombinase Polymerase Amplifi(...) Primer forward pol F5 34 TGGCAGTATTCATTCACAATTTTAAAAGAA(...) 4762-4795 pol UGGCAGUAUUCAUCCACAAUUUUAAAAGAA(...) 5352-5385 170 35.29 40.00 96.64 57.31 20
HIV1ID0069 Recombinase Polymerase Amplifi(...) Primer reverse pol R1 32 TGTATTACTACTGCCCCTTCACCTTTCCAG(...) 4953-4984 pol CUCUGGAAAGGUGAAGGGGCAGUAGUAAUA(...) 5544-5575 170 50.00 40.00 97.07 62.36 20
HIV1ID0070 Recombinase Polymerase Amplifi(...) Primer reverse pol R2 31 CTGTAATAAACCCGAAAATTTTGAATTTTT(...) 4882-4912 pol CAAAAAUUCAAAAUUUUCGGGUUUAUUACA(...) 5473-5503 170 32.26 20.00 95.43 49.23 20
HIV1ID0071 Recombinase Polymerase Amplifi(...) Primer reverse pol R3 34 CCCGAAAATTTTGAATTTTTGTAATTTGTT(...) 4869-4902 pol CAAAAACAAAUUACAAAAAUUCAAAAUUUU(...) 5460-5493 170 29.41 40.00 94.79 54.73 20
HIV1ID0072 Recombinase Polymerase Amplifi(...) Primer reverse pol R4 33 TAATTCTTTAGTTTGTATGTCTGTTGCTAT(...) 4836-4868 pol AUAAUAGCAACAGACAUACAAACUAAAGAA(...) 5427-5459 170 30.30 0.00 93.23 41.18 20
HIV1ID0073 Taqman real-time quantative PC(...) Primer forward polP1 19 199 TGGCATGGGTACCAGCACA 4147-4165 pol UGGCAUGGGUACCAGCACA 4731-4749 170 52.63 80.00 94.47 75.70 21
HIV1ID0074 Taqman real-time quantative PC(...) Primer reverse polP2 22 CTGGCTACTATTTCTTTTGCTA 4324-4345 pol UAGCAAAAGAAAUAGUAGCCAG 4911-4932 170 36.36 40.00 91.94 56.10 21
HIV1ID0075 Taqman real-time quantative PC(...) Probe polprobe 32 TTTATCTACTTGTTCATTTCCTCCAATTCC(...) 4168-4199 pol AAGGAAUUGGAGGAAAUGAACAAGUAGAUA(...) 4752-4783 170 37.50 40.00 94.84 57.45 21
HIV1ID0076 Taqman real-time quantative PC(...) Primer forward gagFW 25 166 TTAAGTGTTTCAATTGTGGCAAAGA 1958-1982 gag UUAAGUGUUUCAAUUGUGGCAAAGA 2375-2399 170 36.00 20.00 89.96 48.65 21
HIV1ID0077 Taqman real-time quantative PC(...) Primer reverse gagRW 30 AAAAAATTAGCCTGTCTCTCAGTACAATCT 2061-2090 gag AGAUUGUACUGAGAGACAGGCUAAUUUUUU 2499-2519 170 9.52 0.00 94.74 34.75 21
HIV1ID0078 Taqman real-time quantative PC(...) Probe gagprobe 27 CCCTAGGAAAAAGGGCTGTTGGAAATG 2010-2036 gag CCCUAGGAAAAAGGGCUGUUGGAAAUG 2427-2453 170 33.33 40.00 92.86 55.40 21
HIV1ID0079 Sequencing Primer forward G00 19 GACTAGCGGAGGCTAGAAG 764-782 gag GACUAGCGGAGGCUAGAAG 1041-1051 102 36.36 60.00 98.12 64.83 15
HIV1ID0080 Sequencing Primer forward G10 22 CAGTATTAAGCGGGGGAGAATT 806-827 gag CAGUAUUAAGCGGGGGAGAAUU 1104-1125 168 9.09 0.00 88.21 32.43 15
HIV1ID0081 Sequencing Primer forward G20 24 GTATGGGCAAGCAGGGAGCTAGAA 892-915 gag GUAUGGGCAAGCAGGGAGCUAGAA 1190-1213 170 33.33 20.00 92.82 48.72 15
HIV1ID0082 Sequencing Primer forward G30 22 CAGTAGCAACCCTCTATTGTGT 1031-1052 gag CAGUAGCAACCCUCUAUUGUGU 1329-1350 170 4.55 0.00 85.50 30.01 15
HIV1ID0083 Sequencing Primer forward G40 20 GACACCAAGGAAGCTTTAGA 1075-1094 gag GACACCAAGGAAGCUUUAGA 1373-1392 170 35.00 0.00 92.60 42.53 15
HIV1ID0084 Sequencing Primer forward G50 18 CACAGCAAGCAGCAGCTG 1133-1150 gag CACAGCAAGCAGCAGCUG 1431-1447 169 0.00 0.00 76.35 25.45 15
HIV1ID0085 Sequencing Primer forward G60 25 CAGCCAAAATTACCCTATAGTGCAG 1173-1197 gag CAGCCAAAAUUACCCUAUAGUGCAG 1548-1572 170 32.00 20.00 90.15 47.38 15
HIV1ID0086 Sequencing Primer forward G70 21 ATGAGGAAGCTGCAGAATGGG 1406-1426 gag AUGAGGAAGCUGCAGAAUGGG 1781-1801 170 52.38 60.00 94.75 69.04 15
HIV1ID0087 Sequencing Primer forward G80 23 ATGAGAGAACCAAGGGGAAGTGA 1471-1493 gag AUGAGAGAACCAAGGGGAAGUGA 1846-1868 170 56.52 80.00 93.32 76.61 15
HIV1ID0088 Sequencing Primer forward G100 18 TAGAAGAAATGATGACAG 1817-1834 gag UAGAAGAAAUGAUGACAG 2204-2221 170 44.44 40.00 98.21 60.88 15
HIV1ID0089 Sequencing Primer forward G110 18 AGGCTAATTTTTTAGGGA 2078-2095 gag AGGCUAAUUUUUUAGGGA 2507-2524 170 22.22 40.00 98.32 53.51 15
HIV1ID0090 Sequencing Primer reverse G01 18 AGGGGTCGTTGCCAAAGA 2264-2281 gag UCUUUGGCAACGACCCCU 2837-2854 170 38.89 0.00 93.77 44.22 15
HIV1ID0091 Sequencing Primer reverse G05 20 TGTTGGCTCTGGTCTGCTCT 2138-2157 gag AGAGCAGACCAGAGCCAACA 2661-2676 19 6.25 20.00 85.39 37.21 15
HIV1ID0092 Sequencing Primer reverse G15 22 CTTTGCCACAATTGAAACACTT 1960-1981 gag AAGUGUUUCAAUUGUGGCAAAG 2377-2398 170 40.91 60.00 90.07 63.66 15
HIV1ID0093 Sequencing Primer reverse G25 23 ATTGCTTCAGCCAAAACTCTTGC 1867-1889 gag GCAAGAGUUUUGGCUGAAGCAAU 2254-2276 170 39.13 80.00 89.96 69.70 15
HIV1ID0094 Sequencing Primer reverse G35 22 CATGCTGTCATCATTTCTTCTA 1817-1838 gag UAGAAGAAAUGAUGACAGCAUG 2204-2225 170 40.91 40.00 98.16 59.69 15
HIV1ID0095 Sequencing Primer reverse G45 22 TTGGACCAACAAGGTTTCTGTC 1740-1761 gag GACAGAAACCUUGUUGGUCCAA 2127-2148 170 22.73 60.00 90.03 57.59 15
HIV1ID0096 Sequencing Primer reverse G65 18 ATGCTGAAAACATGGGTA 1295-1312 gag UACCCAUGUUUUCAGCAU 1670-1687 170 33.33 40.00 94.09 55.81 15
HIV1ID0097 Sequencing Primer reverse G85 20 TGCACTATAGGGTAATTTTG 1177-1196 gag CAAAAUUACCCUAUAGUGCA 1552-1571 170 35.00 60.00 93.20 62.73 15
HIV1ID0098 Sequencing Primer forward E0 33 TAGAGCCCTGGAAGCATCCAGGAAGTCAGC(...) 5853-5885 env UAGAGCCCUGGAAGCAUCCAGGAAGUCAGC(...) 6488-6520 170 33.33 40.00 91.06 54.80 15
HIV1ID0099 Sequencing Primer forward E00 28 TAGAAAGAGCAGAAGACAGTGGCAATGA 6201-6228 env UAGAAAGAGCAGAAGACAGUGGCAAUGA 6920-6948 170 31.03 40.00 93.23 54.75 15
HIV1ID0100 Sequencing Primer forward E10 26 TTGTGGGTCACAGTCTATTATGGGGT 6324-6349 env UUGUGGGUCACAGUCUAUUAUGGGGU 7068-7093 170 30.77 60.00 92.04 60.94 15
HIV1ID0101 Sequencing Primer forward E20 27 GGGCCACACATGCCTGTGTACCCACAG 6430-6456 env GGGCCACACAUGCCUGUGUACCCACAG 7174-7200 170 29.63 20.00 94.42 48.02 15
HIV1ID0102 Sequencing Primer forward E30 27 GTGTACCCACAGACCCCAGCCCACAAG 6445-6471 env GUGUACCCACAGACCCCAACCCACAAG 7189-7215 170 22.22 0.00 93.08 38.43 15
HIV1ID0103 Sequencing Primer forward E40 27 CATGTGGAAAAATGACATGGTGGATCA 6506-6532 env CAUGUGGAAAAAUGACAUGGUAGAACA 7253-7279 170 25.93 60.00 88.89 58.27 15
HIV1ID0104 Sequencing Primer forward E50 26 CATGGTAGAGCAGATGCAGGAGGATG 6521-6546 env CAUGGUAGAACAGAUGCAUGAGGAUA 7268-7293 170 38.46 40.00 85.94 54.80 15
HIV1ID0105 Sequencing Primer forward E60 23 TAATCAGTTTATGGGATCAAAGC 6547-6569 env UAAUCAGUUUAUGGGAUCAAAGC 7294-7311 170 5.56 20.00 89.99 38.52 15
HIV1ID0106 Sequencing Primer forward E70 27 GGGATCAAAGCCTAAAGCCATGTGTAA 6559-6585 env GGGAUCAAAGCCUAAAGCCAUGUGUAA 7315-7335 170 14.29 0.00 92.91 35.73 15
HIV1ID0107 Sequencing Primer forward E80 22 CCAATTCCCATACATTATTGTG 6858-6879 env CCAAUUCCCAUACAUUAUUGUG 7746-7767 170 27.27 20.00 93.81 47.03 15
HIV1ID0108 Sequencing Primer forward E90 24 CACAGTACAATGTACACATGGAAT 6953-6976 env CACAGUACAAUGUACACAUGGAAU 7854-7870 170 41.18 40.00 94.96 58.71 15
HIV1ID0109 Sequencing Primer forward E100 20 ACACATGGAATTAAGCCAGT 6966-6985 env ACACAUGGAAUUAGGCCAGU 7860-7879 170 35.00 40.00 92.79 55.93 15
HIV1ID0110 Sequencing Primer forward E110 24 CTGTTAAATGGCAGTCTAGCAGAA 7002-7025 env CUGUUAAAUGGCAGUCUAGCAGAA 7896-7919 170 29.17 20.00 88.29 45.82 15
HIV1ID0111 Sequencing Primer forward E120 24 GTAGAAATTAATTGTACAAGACCC 7098-7121 env GUAGAAAUUAAUUGUACAAGACCC 7995-8018 170 12.50 20.00 78.68 37.06 15
HIV1ID0112 Sequencing Primer forward E130 23 ACAAATTATAAACATGTGGCAGG 7487-7509 env ACAAAUUAUAAACAUGUGGCAGA 8479-8502 170 4.17 0.00 86.07 30.08 15
HIV1ID0113 Sequencing Primer forward E140 24 GTGAATTATATAAATATAAAGTAG 7666-7689 env GUGAAUUAUAUAAAUAUAAAGUAG 8706-8729 170 29.17 0.00 92.16 40.44 15
HIV1ID0114 Sequencing Primer forward E160 27 GTGGGAATAGGAGCTGTGTTCCTTGGG 7761-7787 env GUGGGAAUAGGAGCUUUGUUCCUUGGG 8828-8851 169 4.17 20.00 83.02 35.73 15
HIV1ID0115 Sequencing Primer forward E170 18 AGCAGGAAGCACTATGGG 7799-7816 env AGCAGGAAGCACUAUGGG 8863-8880 170 33.33 60.00 97.68 63.67 15
HIV1ID0116 Sequencing Primer forward E180 20 GTCTGGTATAGTGCAACAGCA 7860-7879 env UCUGGUAUAGUGCAGCAGCA 8924-8943 170 60.00 80.00 95.14 78.38 15
HIV1ID0117 Sequencing Primer forward E210 24 TAACAAATTGGCTGTGGTATATAA 8248-8271 env UAACAAAUUGGCUGUGGUAUAUAA 9342-9365 170 8.33 20.00 89.07 39.13 15
HIV1ID0118 Sequencing Primer forward E260 25 TTCAGCTACCACCGCTTGAGAGACT 8520-8544 env UUCAGCUACCACCGCUUGAGAGACU 9640-9664 170 24.00 20.00 92.52 45.51 15
HIV1ID0119 Sequencing Primer forward E270 20 GTGGAACTTCTGGGACGCAG 8568-8587 env GUGGAACUUCUGGGACGCAG 9709-9726 170 0.00 0.00 89.87 29.96 15
HIV1ID0120 Sequencing Primer reverse E01 26 TCCAGTCCCCCCTTTTCTTTTAAAAA 9064-9089 env UUUUUAAAAGAAAAGGGGGGACUGGA 10311-10336 164 3.85 0.00 98.11 33.99 15
HIV1ID0121 Sequencing Primer reverse E03 26 TAAGTCATTGGTCTTAAAGGTACCTG 9013-9038 env CAGGUACCUUUAAGACCAAUGACUUA 10257-10285 164 17.24 20.00 89.52 42.26 15
HIV1ID0122 Sequencing Primer reverse E05 22 TATTTGAGGGCTTCCCACCCCC 8587-8608 env GGGGGUGGGAAGCCCUCAAAUA 9749-9770 170 9.09 0.00 84.44 31.18 15
HIV1ID0123 Sequencing Primer reverse E15 22 CTCTCTCTCCACCTTCTTCTTC 8424-8445 env GAAGAAGAAGGUGGAGAGAGAG 9533-9556 170 4.17 0.00 90.37 31.51 15
HIV1ID0124 Sequencing Primer reverse E45 19 CCTGCCTAACTCTATTCAC 8337-8355 env GUGAAUAGAGUUAGGCAGG 9431-9449 170 15.79 0.00 91.40 35.73 15
HIV1ID0125 Sequencing Primer reverse E55 27 GCCCCAGACTGTGAGTTGCAACAGATG 7914-7940 env CAUCUGUUGCAACUCACAGUCUGGGGC 8978-9004 170 25.93 20.00 91.49 45.81 15
HIV1ID0126 Sequencing Primer reverse E65 18 AGTGCTTCCTGCTGCTCC 7794-7811 env GGAGCAGCAGGAAGCACU 8858-8875 170 16.67 0.00 95.74 37.47 15
HIV1ID0127 Sequencing Primer reverse E75 27 GCGCCCATAGTGCTTCCTGCTGCTCCC 7793-7819 env GGGAGCAGCAGGAAGCACUAUGGGCGC 8857-8883 170 29.63 0.00 95.32 41.65 15
HIV1ID0128 Sequencing Primer reverse E85 27 GTCCCTCATATCTCCTCCTCCAGGTCT 7629-7655 env AGACCUGGAGGAGGAGAUAUGAGGGAC 8669-8695 170 25.93 0.00 88.96 38.29 15
HIV1ID0129 Sequencing Primer reverse E95 18 GATGGGAGGGGCATACAT 7524-7541 env AUGUAUGCCCCUCCCAUC 8522-8539 170 16.67 0.00 90.06 35.58 15
HIV1ID0130 Sequencing Primer reverse E105 21 GCTTTTCCTACTTCCTGCCAC 7512-7532 env GUAGGAAAAGCAAUGUAUGCC 8510-8530 170 4.76 0.00 88.79 31.18 15
HIV1ID0131 Sequencing Primer reverse E115 24 AGAAAAATTCCCCTCCACAATTAA 7351-7374 env UUAAUUGUGGAGGGGAAUUUUUCU 8313-8336 170 16.67 0.00 91.48 36.05 15
HIV1ID0132 Sequencing Primer reverse E125 24 CAATTTCTGGGTCCCCTCCTGAGG 7315-7338 env CCUCAGGAGGGGACCCAGAAAUUG 8279-8300 170 31.82 40.00 86.47 52.76 15
HIV1ID0133 Sequencing Primer reverse E135 28 AGCTGTACTATTATGGTTTTAGCATTGT 7060-7087 env ACAAUGCUAAAACCAUAAUAGUACAGCU 7957-7984 170 14.29 20.00 84.56 39.62 15
HIV1ID0134 Sequencing Primer reverse E145 24 CAGCAGTTGAGTTGATACTACTGG 6981-7004 env CCAGUAGUAUCAACUCAACUGCUG 7875-7898 170 25.00 40.00 88.20 51.07 15
HIV1ID0135 Sequencing Primer reverse E165 27 GGGGTCTGTGGGTACACAGGCATGTGT 6435-6461 env ACACAUGCCUGUGUACCCACAGACCCC 7179-7205 170 18.52 20.00 94.39 44.30 15
HIV1ID0136 Sequencing Primer reverse E175 24 TTTAGCATCTGATGCACAAAATAG 6378-6401 env CUAUUUUGUGCAUCAGAUGCUAAA 7122-7145 170 20.83 0.00 92.80 37.88 15
HIV1ID0137 cDNA synthesis Degenerated primer forward GAG2FWD 21 RGAYATAARRCARGGRCCAAA 1638-1658 gag GGACAUAAGACAAGGACCAAA 2025-2045 170 52.38 80.00 92.52 74.97 22
HIV1ID0138 cDNA synthesis Degenerated primer reverse GAG2REV 22 CTTKCCACAYTTCCARCARCCC 2022-2043 gag GGGCUGUUGGAAAUGUGGAAAG 2439-2460 170 18.18 20.00 91.50 43.23 22
HIV1ID0139 Nested PCR Degenerated primer reverse M/Op24-7 18 CCCTGRCAKGCTYCATCA 1834-1851 gag GCAUGUCAGGGAGUAGGA 2221-2238 170 33.33 20.00 93.85 49.06 23
HIV1ID0140 Nested PCR Degenerated primer forward M/Op24-1 20 AGYCAAAATTWYCCYATAGT 1174-1193 gag AGCCAAAAUUACCCUAUAGU 1549-1568 170 35.00 20.00 92.37 49.12 23
HIV1ID0141 Nested PCR Degenerated primer forward M/Op24-2 20 AGRACYTTRAAYGCATGGGT 1237-1256 gag AGAACUUUAAAUGCAUGGGU 1612-1631 170 35.00 40.00 92.39 55.80 23
HIV1ID0142 Nested PCR Degenerated primer reverse M/Op24-6 19 TGTGWAGCTTGYTCRGCTC 1703-1721 gag GAGCCGAGCAAGCUUCACA 2090-2108 170 42.11 40.00 88.07 56.73 23
HIV1ID0143 Nested PCR Degenerated primer reverse M/Op24-4 19 ATKTCTCCYACTGGRAYAG 1553-1571 gag CUAUCCCAGUAGGAGAAAU 1940-1958 170 36.84 0.00 88.97 41.94 23
HIV1ID0144 Nested PCR Degenerated primer reverse JH38 20 GGTGARTATCCCTKCCTAAC 8346-8365 env GUUAGGCAGGGAUAUUCACC 9440-9459 170 35.00 40.00 95.88 56.96 23
HIV1ID0145 Nested PCR Degenerated primer forward JH41 19 CAGCAGGAAGCACUAUGGG 7798-7816 env CAGCAGGAAGCACUAUGGG 8862-8880 170 31.58 60.00 97.68 63.09 23
HIV1ID0146 Nested PCR Degenerated primer forward env27F 19 CTGGYATAGTGCARCARCA 7861-7879 env CUGGUAUAGUGCAGCAGCA 8925-8943 170 63.16 80.00 95.13 79.43 23
HIV1ID0147 Nested PCR Degenerated primer reverse menv19R 22 AARCCTCCTACTATCATTATRA 8278-8299 env UCAUAAUGAUAGUAGGAGGCUU 9372-9393 170 9.09 0.00 92.45 33.85 23
HIV1ID0148 Nested PCR Degenerated primer forward JH37 19 GTCTGGGGCATYAARCAGC 7932-7950 env GUCUGGGGCAUCAAGCAGC 8996-9014 170 42.11 60.00 94.70 65.60 23
HIV1ID0149 Nested PCR Degenerated primer forward menv17F 20 TYAARCAGCTCCAGRCAAGA 7942-7961 env UCAAGCAGCUCCAGGCAAGA 9006-9025 170 40.00 40.00 93.48 57.83 23
HIV1ID0150 Nested PCR Degenerated primer reverse JH42 20 CCAAYTCCACARAYTTKCCC 8221-8240 env GGGCAAGUUUGUGGAAUUGG 9315-9334 170 15.00 20.00 85.75 40.25 23
HIV1ID0151 Multiplex real-time PCR & Flow(...) Probe SK102 33 GAGACCATCAATGAGGAAGCTGCAGAATGG(...) 1396-1428 gag GAGACCAUCAAUGAGGAAGCUGCAGAAUGG(...) 1771-1803 170 54.55 80.00 92.04 75.53 7
HIV1ID0152 Multiplex real-time PCR & Flow(...) Primer forward SK431 27 TGCTATGTCAGTTCCCCTTGGTTCTCT 1491-1517 gag UGACAUAGCAGGAACUACUAGUACCCU 1866-1892 170 29.63 0.00 92.92 40.85 7
HIV1ID0153 One-step RT-PCR Primer forward Pan-HIV-1_1F 17 1928 AGCCYGGGAGCTCTCTG 480-496 LTR AGCCUGGGAGCUCUCUG 597-613 40 23.53 60.00 96.24 59.92 24
HIV1ID0154 One-step RT-PCR Primer reverse Pan-HIV-1_1R 23 CCTCCAATTCCYCCTATCATTTT 2385-2407 pol AAAAUGAUAGGGGGAAUUGGAGG 2961-2983 170 26.09 0.00 96.83 40.97 24
HIV1ID0155 One-step RT-PCR Primer forward Pan-HIV-1_2F 21 3574 GGGAAGTGAYATAGCWGGAAC 1485-1505 gag GGGAAGUGACAUAGCAGGAAC 1860-1880 170 42.86 40.00 94.55 59.14 24
HIV1ID0156 One-step RT-PCR Primer reverse Pan-HIV-1_2R 22 CTGCCATCTGTTTTCCATARTC 5037-5058 pol GAUUAUGGAAAACAGAUGGCAG 5628-5649 170 54.55 40.00 97.67 64.07 24
HIV1ID0157 One-step RT-PCR Primer forward Pan-HIV-1_3F 23 3066 TTAAAAGAAAAGGGGGGATTGGG 4783-4805 pol UUAAAAGAAAAGGGGGGAUUGGG 5373-5396 170 45.83 40.00 98.40 61.41 24
HIV1ID0158 One-step RT-PCR Primer reverse Pan-HIV-1_3R 18 TGGCYTGTACCGTCAGCG 7831-7848 env CGCUGACGGUACAGGCCA 8895-8912 170 44.44 40.00 97.22 60.55 24
HIV1ID0159 One-step RT-PCR Primer forward Pan-HIV-1_4F 19 3551 CCTATGGCAGGAAGAAGCG 5967-5985 env CCUAUGGCAGGAAGAAGCG 6617-6635 170 57.89 60.00 97.26 71.72 24
HIV1ID0160 One-step RT-PCR Primer reverse Pan-HIV-1_4R 21 CTTWTATGCAGCWTCTGAGGG 9497-9517 LTR CCCUCAGAUCCUGCAUAUAAG 532-547 31 56.25 20.00 93.24 56.50 24
HIV1ID0161 PCR Primer forward RU5F 20 170 TTAAGCCTCAATAAAGCTTG 518-537 LTR UUAAGCCUCAAUAAAGCUUG 639-656 45 16.67 40.00 94.08 50.25 25
HIV1ID0162 PCR Primer reverse RU5R 26 GCGCCACTGCTAGAGATTTTCCACAC 616-641 LTR GUGUGGAAAAUCUCUAGCAGUGGCGC 766-796 79 0.00 0.00 88.20 29.40 25
HIV1ID0163 PCR Primer forward intF 20 425 CCCTACAATCCCCAAAGTCA 4653-4672 pol CCCUACAAUCCCCAAAGUCA 5243-5262 170 60.00 80.00 96.62 78.87 25
HIV1ID0164 PCR Primer reverse intR 20 CTTGCCACACAATCATCACC 5058-5077 pol GGUGAUGAUUGUGUGGCAAG 5649-5668 170 30.00 20.00 94.56 48.19 25
HIV1ID0165 PCR Primer forward tatF 20 118 GAAGCATCCAGGAAGTCAGC 5863-5882 env GAAGCAUCCAGGAAGUCAGC 6498-6517 170 40.00 20.00 88.71 49.57 25
HIV1ID0166 PCR Primer reverse tatR 20 CTTCCTGCCATAGGAGATGC 5961-5980 env GCAUCUCCUAUGGCAGGAAG 6611-6630 170 45.00 20.00 95.28 53.43 25
HIV1ID0167 PCR Primer forward vprF 19 162 AACAAGCCCCAGAAGACCA 5563-5581 env AACAAGCCCCAGAAGACCA 6178-6196 170 31.58 60.00 93.63 61.74 25
HIV1ID0168 PCR Primer reverse vprR 19 CTGCCCAAGTATCCCCATA 5706-5724 env UAUGGGGAUACUUGGGCAG 6322-6340 170 31.58 60.00 89.00 60.19 25
HIV1ID0169 Real-time PCR Primer reverse B3 21 CCTACATACAAATCATCCATG 3098-3118 pol CAUGGAUGAUUUGUAUGUAGG 3677-3697 170 28.57 20.00 92.93 47.17 26
HIV1ID0170 Real-time PCR Primer reverse F3 21 AGTTCCCTTAGATAAAGACTT 2900-2920 pol AGUUCCCUUAGAUGAAGACUU 3479-3499 170 9.52 20.00 83.08 37.54 26
HIV1ID0171 Recombinase Polymerase Amplifi(...) Primer reverse GAGR1 20 TTATTGTGACGAGGGGTCGC 2273-2292 gag ACGACCCCUCGUCACAAUAA 2846-2865 170 30.00 80.00 85.62 65.21 27
HIV1ID0172 Real-time PCR Primer forward 5' Repliprimer 20 263 CCAGGAAGATGGAAACCAAA 2367-2386 pol CCAGGAAGAUGGAAACCAAA 2943-2962 170 35.00 40.00 95.19 56.73 28
HIV1ID0173 Real-time PCR Primer reverse 3' Repliprimer 20 GTCAATGGCCATTGTTTAAC 2610-2629 pol GUUAAACAAUGGCCAUUGAC 3189-3208 170 40.00 20.00 94.82 51.61 28
HIV1ID0174 Real-time PCR Probe Repliprobe 24 TGTCTTACTTTGATAAAACCTCC 2403-2426 pol GGAGGUUUUAUCAAAGUAAGACAG 2979-3002 170 29.17 40.00 92.44 53.87 28
HIV1ID0175 PCR Primer forward AV1O 30 TGTGACTCTGGTAACTAGAGATCCCTCAGA 574-603 LTR UGUGACUCUGGUAACUAGAGAUCCCUCAGA 725-750 61 53.85 60.00 97.48 70.44 29
HIV1ID0176 PCR Primer forward AV11 15 TCTAGCAGTGGCGCC 628-642 LTR UCUAGCAGUGGCGCC 787-797 78 9.09 0.00 95.68 34.92 29
HIV1ID0177 PCR Primer reverse AV12 15 GACGCTCTCGCACCC 792-806 gag GGGUGCGAGAGCGUC 1090-1104 168 13.33 20.00 98.70 44.01 29
HIV1ID0178 PCR Primer reverse AV13 29 GGCAAGCAGGGAGCTAGAACGATTCGCAG 897-925 gag GGCAAGCAGGGAGCUAGAACGAUUCGCAG 1195-1223 170 31.03 60.00 88.34 59.79 29
HIV1ID0179 Nested PCR Primer forward HPOL4235 23 CCCTACAATCCCCAAAGTCAAGG 4653-4675 pol CCCUACAAUCCCCAAAGUCAAGG 5243-5265 170 60.87 80.00 95.85 78.91 30
HIV1ID0180 Nested PCR Primer reverse HPOL4538 22 TACTGCCCCTTCACCTTTCCA 4956-4976 pol UGGAAAGGUGAAGGGGCAGUA 5547-5567 170 61.90 60.00 98.64 73.52 30
HIV1ID0181 Nested PCR Primer forward HPOL4327 23 TAAGACAGCAGTACAAATGGCAG 4745-4767 pol UAAGACAGCAGUACAAAUGGCAG 5335-5357 170 39.13 60.00 96.39 65.17 30
HIV1ID0182 Nested PCR Primer reverse HPOL4481 21 GCTGTCCCTGTAATAAACCCG 4899-4919 pol CGGGUUUAUUACAGGGACAGC 5490-5510 170 57.14 80.00 96.57 77.90 30
HIV1ID0183 Nested PCR Primer forward HENV5944 26 GCAACCACCACTCTCTATTTTGTGC 6366-6391 env GCAACCACCACUCUAUUUUGUGCAUC 7110-7135 170 19.23 40.00 85.18 48.14 30
HIV1ID0184 Nested PCR Primer reverse HENV6154 25 AGAGTGGGGTTAATTTTACACATGG 6576-6600 env CCAUGUGUAAAAUUAACCCCACUCU 7326-7353 170 14.29 60.00 90.02 54.77 30
HIV1ID0185 Nested PCR Primer forward HENV6009 20 GGCCACACATGCCTGTGTAC 6431-6450 env GGCCACACAUGCCUGUGUAC 7175-7194 170 30.00 20.00 94.09 48.03 30
HIV1ID0186 Nested PCR Primer reverse HENV6135 21 GGCTTTAGGCTTTGATCCCAT 6557-6577 env AUGGGAUCAAAGCCUAAAGCC 7304-7327 170 12.50 20.00 90.37 40.96 30
HIV1ID0187 Nested PCR Primer forward AV18 30 GCACCCACCAAGGCAAAGAGAAGAGTGGTG 7713-7742 env GCACCCACCAAGGCAAAGAGAAGAGUGGUG 8753-8785 170 21.21 20.00 88.15 43.12 29
HIV1ID0188 Nested PCR Primer forward AV19 16 AGGAAGCACTATGGGC 7802-7817 env AGGAAGCACUAUGGGC 8866-8881 170 43.75 60.00 97.75 67.17 29
HIV1ID0189 Nested PCR Primer reverse AV20 16 GCTGCTTGATGCCCCA 7935-7950 env UGGGGCAUCAAGCAGC 8999-9014 170 43.75 40.00 93.92 59.22 29
HIV1ID0190 Nested PCR Primer reverse AV21 27 TCCACAGCCAGGACTCTTGCCTGGAGCTG 7949-7975 env GCUCCAGGCAAGAAUCCUGGCUGUGGA 9013-9039 170 25.93 40.00 92.90 52.94 29
HIV1ID0191 RT-LAMP Primer forward p24F3 19 225 ATTATCAGAAGGAGCCACC 1311-1329 gag AUUAUCAGAAGGAGCCACC 1686-1704 170 31.58 20.00 92.84 48.14 31
HIV1ID0192 RT-LAMP Primer reverse p24B3 21 CATCCTATTTGTTCCTGAAGG 1515-1535 gag CCUUCAGGAACAAAUAGGAUG 1890-1910 170 28.57 0.00 88.25 38.94 31
HIV1ID0193 RT-LAMP Primer forward p24LoopF 25 124 TTTAACATTTGCATGGCTGCTTGAT 1370-1394 gag AUCAAGCAGCCAUGCAAAUGUUAAA 1745-1769 170 56.00 40.00 91.81 62.60 31
HIV1ID0194 RT-LAMP Primer reverse p24LoopR 19 GAGATCCAAGGGGAAGTGA 1475-1493 gag GAGAACCAAGGGGAAGUGA 1850-1868 170 63.16 60.00 94.57 72.58 31
HIV1ID0195 RT-LAMP Primer forward proteaseF3 18 211 AAAGATAGGGGGGCAACT 2291-2308 gag AAAGAUAGGGGGGCAACU 2864-2881 170 16.67 0.00 81.19 32.62 31
HIV1ID0196 RT-LAMP Primer reverse proteaseB3 20 GTTGACAGGTGTAGGTCCTA 2482-2501 gag UAGGACCUACACCUGUCAAC 3058-3077 170 50.00 40.00 94.35 61.45 31
HIV1ID0197 RT-LAMP Primer forward proteaseLoopF 22 95 TATTTCTTCTAATACTGTATCA 2334-2355 gag GCAGAUGAUACAGUAUUAGAAG 2907-2928 170 40.91 20.00 97.80 52.90 31
HIV1ID0198 RT-LAMP Primer reverse proteaseLoopR 18 TATCAAAGTAAGACAGTA 2411-2428 gag UAUCAAAGUAAGACAGUA 2987-3004 170 27.78 20.00 92.00 46.59 31
HIV1ID0199 Alu-PCR Primer forward MH531 20 143 TGTGTGCCCGTCTGTTGTGT 557-576 LTR UGUGUGCCCGUCUGUUGUGU 688-708 61 0.00 0.00 93.32 31.11 32
HIV1ID0200 Alu-PCR Primer reverse MH532 20 GAGTCCTGCGTCGAGAGAGC 680-699 LTR GCUCUCUCGACGCAGGACUC 896-915 96 0.00 0.00 91.60 30.53 32
HIV1ID0201 Alu-PCR Probe LRT-P 20 CAGTGGCGCCCGAACAGGGA 633-652 LTR CAGUGGCGCCCGAACAGGGA 788-807 80 5.00 20.00 96.83 40.61 32
HIV1ID0202 Alu-PCR Primer forward MH535 23 AACTAGGGAACCCACTGCTTAAG 500-522 LTR AACUAGGGAACCCACUGCUUAAG 625-643 43 0.00 0.00 93.78 31.26 32
HIV1ID0203 Alu-PCR Primer reverse MH536 24 TCCACAGATCAAGGATATCTTGTC 28-51 LTR GACAAGAUAUCCUUGAUCUGUGGA 32-53 25 4.55 40.00 85.39 43.31 32
HIV1ID0204 Alu-PCR Probe MH603 30 ACACTACTTGAAGCACTCAAGGCAAGCTTT 530-559 LTR AAAGCUUGCCUUGAGUGCUUCAAGUAGUGU 660-690 52 0.00 0.00 90.80 30.27 32
HIV1ID0205 qRT-PCR PCR primer forward "HIV-1" 22 CCAAAGTAGCATGACAAAAATC 3029-3050 pol CCAAAGUAGCAUGACAAAAAUC 3608-3629 170 36.36 20.00 89.11 48.49 42
HIV1ID0206 qRT-PCR PCR primer reverse "HIV-1" 28 GTTCATAACCCATCCAAAGGAATGGAGG 3222-3249 pol CCUCCAUUCCUUUGGAUGGGUUAUGAAC 3802-3829 170 42.86 80.00 91.73 71.53 42
HIV1ID0207 PCR Probe "Proviral HIV-1" 26 AGTAGTGTGTGCCCGTCTGTTTAMRA 9637-9662 LTR AGUAGUGUGUGCCCGUCUGUUGUGUG 11050-11075 29 0.00 0.00 57.39 19.13 43
HIV1ID0208 PCR PCR primer forward "Proviral HIV-1" 22 GGTCTCTCTGGTTAGACCAGAT 455-476 LTR GGUCUCUCUGGUUAGACCAGAU 570-593 36 16.67 60.00 90.06 55.58 43
HIV1ID0209 PCR PCR primer reverse "Proviral HIV-1" 22 CTGCTAGAGATTTTCCACACTG 614-635 LTR CAGUGUGGAAAAUCUCUAGCAG 764-776 72 0.00 0.00 70.26 23.42 43
HIV1ID0210 Site-directed mutagenesis PCR primer "XS 431V R" 33 GAGAGACAGGTTAATTTTTTAGGGAAGATC(...) 2071-2104 gag GAGAGACAGGCUAAUUUUUUAGGGAAGAUC(...) 2500-2533 170 17.65 40.00 93.46 50.37 44
HIV1ID0211 Site-directed mutagenesis PCR primer "XS 431V F" 33 CCAGATCTTCCCTAAAAAATTAACCTGTCT(...) 2091-2124 gag AGGGAAGAUCUGGCCUUCCUACAAGGGAAG(...) 2520-2543 170 20.83 0.00 90.28 37.04 44
HIV1ID0212 Site-directed mutagenesis PCR primer "V18BS 431 AR" 30 CCCTAAAAAATTAGCCTGTCTCTCAGTACA 2065-2094 gag UGUACUGAGAGACAGGCUAAUUUUUUAGGG 2499-2523 170 12.00 20.00 95.42 42.47 44
HIV1ID0213 Site-directed mutagenesis PCR primer "V18BS 431 AF" 30 TGTACTGAGAGACAGGCTAATTTTTTAGGG 2065-2094 gag UGUACUGAGAGACAGGCUAAUUUUUUAGGG 2499-2523 170 12.00 20.00 95.42 42.47 44
HIV1ID0214 Site-directed mutagenesis PCR primer "V16XS 437 VR" 30 CCTTGTGGGAAGGCCAGACCTTCCCTAAAA 61-90 5'LTR CACAAGGCUACUUCCCUGAUUAGCAGAACU 63-92 28 10.00 40.00 88.27 46.09 44
HIV1ID0215 Site-directed mutagenesis PCR primer "V16XS 437 VF" 30 TTTTAGGGAAGGTCTGGCCTTCCCACAAGG 2087-2116 gag UUUUAGGGAAGAUCUGGCCUUCCUACAAGG 2516-2543 170 17.86 0.00 91.50 36.45 44
HIV1ID0216 Site-directed mutagenesis PCR primer "V16BS 437 IR" 34 GGGGGAAGGCCAGATCTTCCCTAAAAAATT(...) 2079-2112 gag GGCUAAUUUUUUAGGGAAGAUCUGGCCUUC(...) 2508-2541 170 17.65 0.00 92.57 36.74 44
HIV1ID0217 Site-directed mutagenesis PCR primer "V16BS 437 IF" 34 GGCTAATTTTTTAGGGAAGATCTGGCCTTC(...) 2079-2112 gag GGCUAAUUUUUUAGGGAAGAUCUGGCCUUC(...) 2508-2541 170 17.65 0.00 92.57 36.74 44
HIV1ID0218 Site-directed mutagenesis PCR primer "V13BS 431AR" 26 CCCTAAAAAATTAGCCTGTCTCTCAG 2069-2094 gag CUGAGAGACAGGCUAAUUUUUUAGGG 2499-2523 170 12.00 20.00 95.42 42.47 44
HIV1ID0219 Site-directed mutagenesis PCR primer "V13BS 431AF" 26 CTGAGAGACAGGCTAATTTTTTAGGG 2069-2094 gag CUGAGAGACAGGCUAAUUUUUUAGGG 2499-2523 170 12.00 20.00 95.42 42.47 44
HIV1ID0220 PCR PCR primer forward "5'HIV-TR-16" 26 CCTCTATTGTGTGCATCAAAGGATAG 1041-1066 gag CCUCUAUUGUGUGCAUCAAAGGAUAG 1339-1364 170 11.54 20.00 83.13 38.22 45
HIV1ID0221 PCR PCR primer reverse "5'HIV-TR-16" 26 GGCTTCCTTGGTGTCTTTTACATCTA 1089-1114 gag UUUAGACAAGAUAGAGGAAGAGCAAA 1387-1412 170 3.85 0.00 79.32 27.72 45
HIV1ID0222 PCR PCR primer forward "5'HIV-TR-15" 23 ACAACCATCCCTTCAGACAGGAT 981-1003 gag ACAACCAUCCCUUCAGACAGGAU 1279-1301 170 17.39 20.00 80.87 39.42 45
HIV1ID0223 PCR PCR primer reverse "5'HIV-TR-15" 25 CCTTTGATGCACACAATCGAGGACT 1038-1062 gag AACCCUCUAUUGUGUGCAUCAAAGG 1336-1360 170 8.00 20.00 80.48 36.16 45
HIV1ID0224 PCR PCR primer forward "5'HIV-TR-14" 22 ACTGGGACAGCTACAACCATCC 969-990 gag ACUGGGACAGCUACAACCAUCC 1267-1288 170 4.55 20.00 76.04 33.53 45
HIV1ID0225 PCR PCR primer reverse "5'HIV-TR-14" 25 AAGTTCTTCTGATCCTGTCTGAAGG 990-1014 gag CCUUCAGACAGGAUCAGAAGAACUU 1288-1312 170 20.00 0.00 83.82 34.61 45
HIV1ID0226 PCR PCR primer forward "5'HIV-TR-13" 26 GAGACATCAGAAGGCTGTAGACAAAT 923-943 gag CAGUUAAUCCUGGCCUGUUAG 1221-1241 170 9.52 0.00 86.81 32.11 45
HIV1ID0227 PCR PCR primer reverse "5'HIV-TR-13" 21 GGATGGTTGTAGCTGTCCCAG 970-990 gag CUGGGACAGCUACAACCAUCC 1268-1288 170 4.76 0.00 75.01 26.59 45
HIV1ID0228 PCR PCR primer forward "5'HIV-TR-12" 22 GATTCGCAGTTAATCCTGGCCT 918-938 gag AUUCGCAGUUAAUCCUGGCCU 1216-1236 170 9.52 0.00 86.99 32.17 45
HIV1ID0229 PCR PCR primer reverse "5'HIV-TR-12" 28 CCAGTATTTGTCTACAGCCTTCTGATGT 946-973 gag ACAUCAGAAGGCUGUAGACAAAUACUGG 1244-1271 170 7.14 0.00 80.52 29.22 45
HIV1ID0230 PCR PCR primer forward "5'HIV-TR-11" 21 GGGAGCTAGAACGATTCGCAG 905-925 gag GGGAGCUAGAACGAUUCGCAG 1203-1223 170 14.29 20.00 84.01 39.43 45
HIV1ID0231 PCR PCR primer reverse "5'HIV-TR-11" 26 CTGATGTCTCTAAAAGGCCAGGATTA 927-952 gag UAAUCCUGGCCUGUUAGAAACAUCAG 1225-1250 170 7.69 0.00 86.63 31.44 45
HIV1ID0232 PCR PCR primer forward "5'HIV-TR-10" 21 AAAATTCGGTTAAGGCCAGGG 841-861 gag AAAAUUCGGUUAAGGCCAGGG 1139-1159 168 14.29 20.00 89.34 41.21 45
HIV1ID0233 PCR PCR primer reverse "5'HIV-TR-10" 25 GGATTAACTGCGAATCGTTCTAGCT 908-932 gag AGCUAGAACGAUUCGCAGUUAAUCC 1206-1230 170 12.00 0.00 83.89 31.96 45
HIV1ID0234 PCR PCR primer forward "5'HIV-TR-8" 23 GCGGAGGCTAGAAGGAGAGAGAT 769-791 LTR GCGGAGGCUAGAAGGAGAGAGAU 1041-1051 102 36.36 60.00 98.12 64.83 45
HIV1ID0235 PCR PCR primer reverse "5'HIV-TR-8" 21 TAATACCGACGCTCTCGCACC 813-835 gag AAGCGGGGGAGAAUUAGAUCGAU 1111-1133 168 13.04 20.00 84.57 39.21 45
HIV1ID0236 PCR PCR primer forward "5'HIV-TR-9" 21 GCGAGAGCGTCGGTATTAAGC 796-816 gag GCGAGAGCGUCAGUAUUAAGC 1094-1114 168 9.52 0.00 92.42 33.98 45
HIV1ID0237 PCR PCR primer reverse "5'HIV-TR-9" 19 TTTCCCCCTGGCCTTAACC 848-866 gag GGUUAAGGCCAGGGGGAAA 1146-1164 168 15.79 0.00 89.90 35.23 45
HIV1ID0238 PCR PCR primer forward "5'HIV-TR-7" 21 CGACTGGTGAGTACGCCAAAA 738-758 LTR CGACUGGUGAGUACGCCAAAA 989-1007 99 36.84 0.00 94.34 43.73 45
HIV1ID0239 PCR PCR primer reverse "5'HIV-TR-7" 23 ATCTCTCTCCTTCTAGCCTCCGC 769-791 LTR GCGGAGGCUAGAAGGAGAGAGAU 1041-1051 102 36.36 40.00 98.12 58.16 45
HIV1ID0240 PCR PCR primer forward "5'HIV-TR-6" 20 CAGGACTCGGCTTGCTGAAG 692-711 LTR CAGGACUCGGCUUGCUGAAG 1433-1440 168 0.00 0.00 79.41 26.47 45
HIV1ID0241 PCR PCR primer reverse "5'HIV-TR-6" 15 CACCAGTCGCCGCCC 732-746 LTR GGGCGGCGACUGGUG 989-995 99 14.29 20.00 98.65 44.31 45
HIV1ID0242 PCR PCR primer forward "5'HIV-TR-5" 16 GTGGCGCCCGAACAGG 635-650 LTR GUGGCGCCCGAACAGG 790-805 80 6.25 20.00 96.86 41.04 45
HIV1ID0243 PCR PCR primer reverse "5'HIV-TR-5" 15 TTGCCGTGCGCGCTT 709-723 LTR AAGCGCGCACGGCAA 941-955 98 6.67 0.00 83.91 30.19 45
HIV1ID0244 PCR PCR primer forward "5'HIV-TR-4" 25 GAGATCCCTCAGACCCTTTTAGTCA 591-615 5'LTR GAGAUCCCUCAGACCCUUUUAGUCA 738-765 64 0.00 0.00 84.05 28.02 45
HIV1ID0245 PCR PCR primer reverse "5'HIV-TR-4" 19 TTCAAGTCCCTGTTCGGGC 640-658 LTR GCCCGAACAGGGACCUGAA 795-813 82 0.00 0.00 95.46 31.82 45
HIV1ID0246 PCR PCR primer forward "5'HIV-TR-3" 21 AGTGTGTGCCCGTCTGTTGTG 555-575 5'LTR AGUGUGUGCCCGUCUGUUGUG 686-707 61 0.00 0.00 93.49 31.16 45
HIV1ID0247 PCR PCR primer reverse "5'HIV-TR-3" 27 TGACTAAAAGGGTCTGAGGGATCTCTA 589-615 5'LTR UAGAGAUCCCUCAGACCCUUUUAGUCA 736-765 64 0.00 40.00 85.10 41.70 45
HIV1ID0248 PCR PCR primer forward "5'HIV-TR-2" 23 AAGCCTCAATAAAGCTTGCCTTG 520-542 5'LTR AAGCCUCAAUAAAGCUUGCCUUG 648-668 48 0.00 0.00 94.67 31.56 45
HIV1ID0249 PCR PCR primer reverse "5'HIV-TR-2" 21 AGTCACACAACAGACGGGCAC 560-580 5'LTR GUGCCCGUCUGUUGUGUGACU 691-709 61 0.00 60.00 93.12 51.04 45
HIV1ID0250 PCR PCR primer forward "5'HIV-TR-1" 23 TCTCTGGCTAACTAGGGAACCCA 491-513 5'LTR UCUCUGGCUAACUAGGGAACCCA 608-634 40 37.04 100.00 88.28 75.11 45
HIV1ID0251 PCR PCR primer reverse "5'HIV-TR-1" 23 GCACTCAAGGCAAGCTTTATTGA 525-547 5'LTR UCAAUAAAGCUUGCCUUGAGUGC 648-671 49 0.00 20.00 93.61 37.87 45
HIV1ID0252 PCR PCR primer forward "LEX074" 17 AAGAGTGCTCCCGTGTG 7733-7749 env AAGAGUGGUGCAGAGAG 8773-8843 170 2.82 0.00 85.35 29.39 46
HIV1ID0253 PCR PCR primer reverse "LEX074" 20 GACAATGCAGAACTGGGTAA 7059-7078 env GACAAUGCUAAAACCAUAAU 7956-7975 170 5.00 20.00 82.52 35.84 46
HIV1ID0254 Gene silencing siRNA sense "siControl" 21 GUACCGCACGUCAUUCGUAUC 7838-7858 env GGUACAGGCCAGACAAUUAUU 8902-8922 170 23.81 0.00 92.76 38.86 47
HIV1ID0255 Gene silencing siRNA antisense "siControl" 21 UACGAAUGACGUGCGGUACGU 5538-5558 sor UACGAAACUGACAGAGGAUAG 6153-6173 170 14.29 20.00 78.18 37.49 47
HIV1ID0256 Gene silencing siRNA sense "si7658" 21 GGAGAAGUGAAUUAUAUAAAU 7660-7680 env GGAGAAGUGAAUUAUAUAAAU 8700-8720 170 33.33 20.00 94.12 49.15 47
HIV1ID0257 Gene silencing siRNA antisense "si7658" 21 UUAUAUAAUUCACUUCUCCAA 7658-7678 env UUGGAGAAGUGAAUUAUAUAA 8698-8718 170 33.33 40.00 95.83 56.39 47
HIV1ID0258 Gene silencing siRNA sense "si7653" 21 CAAUUGGAGAAGUGAAUUAUA 7655-7675 env CAAUUGGAGAAGUGAAUUAUA 8695-8715 170 28.57 20.00 95.83 48.13 47
HIV1ID0259 Gene silencing siRNA antisense "si7653" 21 UAAUUCACUUCUCCAAUUGUC 7653-7673 env GACAAUUGGAGAAGUGAAUUA 8693-8713 170 28.57 20.00 95.67 48.08 47
HIV1ID0260 Gene silencing siRNA sense "si4961" 21 GUGAAGGGGCAGUAGUAAUAC 4963-4983 pol GUGAAGGGGCAGUAGUAAUAC 5554-5574 170 47.62 20.00 96.74 54.79 47
HIV1ID0261 Gene silencing siRNA antisense "si4961" 21 AUUACUACUGCCCCUUCACCU 4961-4981 pol AGGUGAAGGGGCAGUAGUAAU 5552-5572 170 52.38 20.00 96.85 56.41 47
HIV1ID0262 Gene silencing siRNA sense "si4960" 21 GGUGAAGGGGCAGUAGUAAUA 4962-4982 pol GGUGAAGGGGCAGUAGUAAUA 5553-5573 170 47.62 0.00 96.74 48.12 47
HIV1ID0263 Gene silencing siRNA antisense "si4960" 21 UUACUACUGCCCCUUCACCUU 4960-4980 pol AAGGUGAAGGGGCAGUAGUAA 5551-5571 170 52.38 20.00 96.85 56.41 47
HIV1ID0264 Gene silencing siRNA sense "si4888" 21 CAAAAUUUUCGGGUUUAUUAC 4890-4910 pol CAAAAUUUUCGGGUUUAUUAC 5481-5501 170 33.33 20.00 96.70 50.01 47
HIV1ID0265 Gene silencing siRNA antisense "si4888" 21 AAUAAACCCGAAAAUUUUGAA 4888-4908 pol UUCAAAAUUUUCGGGUUUAUU 5479-5499 170 28.57 0.00 97.00 41.86 47
HIV1ID0266 Gene silencing siRNA sense "si4840" 21 GCAACAGACAUACAAACUAAA 4842-4862 pol GCAACAGACAUACAAACUAAA 5433-5453 170 28.57 20.00 92.37 46.98 47
HIV1ID0267 Gene silencing siRNA antisense "si4840" 21 UAGUUUGUAUGUCUGUUGCUA 4840-4860 pol UAGCAACAGACAUACAAACUA 5431-5451 170 33.33 40.00 93.88 55.74 47
HIV1ID0268 Gene silencing siRNA sense "si4809" 21 CAGUGCAGGGGAAAGAAUAGU 4811-4831 pol CAGUGCAGGGGAAAGAAUAGU 5402-5422 170 42.86 40.00 96.36 59.74 47
HIV1ID0269 Gene silencing siRNA antisense "si4809" 21 UAUUCUUUCCCCUGCACUGUA 4809-4829 pol UACAGUGCAGGGGAAAGAAUA 5400-5420 170 47.62 60.00 97.96 68.53 47
HIV1ID0270 Gene silencing siRNA sense "si4806" 21 GUACAGUGCAGGGGAAAGAAU 4808-4828 pol GUACAGUGCAGGGGAAAGAAU 5399-5419 170 42.86 60.00 96.43 66.43 47
HIV1ID0271 Gene silencing siRNA antisense "si4806" 21 UCUUUCCCCUGCACUGUACCC 4806-4826 pol GGGUACAGUGCAGGGGAAAGA 5397-5417 170 38.10 60.00 95.95 64.68 47
HIV1ID0272 Gene silencing siRNA sense "si4794" 21 GGGGAUUGGGGGGUACAGUGC 4796-4816 pol GGGGAUUGGGGGGUACAGUGC 5388-5407 170 40.00 40.00 96.97 58.99 47
HIV1ID0273 Gene silencing siRNA antisense "si4794" 21 ACUGUACCCCCCAAUCCCCCC 4794-4814 pol GGGGGGAUUGGGGGGUACAGU 5388-5405 170 38.89 40.00 96.69 58.52 47
HIV1ID0274 Gene silencing siRNA sense "si4753" 21 GUACAAAUGGCAGUAUUCAUC 4755-4775 pol GUACAAAUGGCAGUAUUCAUC 5345-5365 170 23.81 0.00 94.35 39.39 47
HIV1ID0275 Gene silencing siRNA antisense "si4753" 21 UGAAUACUGCCAUUUGUACUG 4753-4773 pol CAGUACAAAUGGCAGUAUUCA 5343-5363 170 28.57 0.00 96.61 41.73 47
HIV1ID0276 Gene silencing siRNA sense "si4751" 21 CAGUACAAAUGGCAGUAUUCA 4753-4773 pol CAGUACAAAUGGCAGUAUUCA 5343-5363 170 28.57 0.00 96.61 41.73 47
HIV1ID0277 Gene silencing siRNA antisense "si4751" 21 AAUACUGCCAUUUGUACUGCU 4751-4771 pol AGCAGUACAAAUGGCAGUAUU 5341-5361 170 33.33 20.00 97.04 50.12 47
HIV1ID0278 Gene silencing siRNA sense "si4750" 21 GCAGUACAAAUGGCAGUAUUC 4752-4772 pol GCAGUACAAAUGGCAGUAUUC 5342-5362 170 33.33 0.00 96.72 43.35 47
HIV1ID0279 Gene silencing siRNA antisense "si4750" 21 AUACUGCCAUUUGUACUGCUG 4750-4770 pol CAGCAGUACAAAUGGCAGUAU 5340-5360 170 38.10 20.00 97.09 51.73 47
HIV1ID0280 Gene silencing siRNA sense "si4746" 21 GACAGCAGUACAAAUGGCAGU 4748-4768 pol GACAGCAGUACAAAUGGCAGU 5338-5358 170 42.86 40.00 96.86 59.91 47
HIV1ID0281 Gene silencing siRNA antisense "si4746" 21 UGCCAUUUGUACUGCUGUCUU 4746-4766 pol AAGACAGCAGUACAAAUGGCA 5336-5356 170 38.10 40.00 96.53 58.21 47
HIV1ID0282 Gene silencing siRNA sense "si4652" 21 CCUACAAUCCCCAAAGUCAAG 4654-4674 pol CCUACAAUCCCCAAAGUCAAG 5244-5264 170 61.90 60.00 95.51 72.47 47
HIV1ID0283 Gene silencing siRNA antisense "si4652" 21 UGACUUUGGGGAUUGUAGGGA 4652-4672 pol UCCCUACAAUCCCCAAAGUCA 5242-5262 170 57.14 80.00 96.01 77.72 47
HIV1ID0284 Gene silencing siRNA sense "si4378" 21 CAUGGACAAGUAGACUGUAGU 4380-4400 pol CAUGGACAAGUAGACUGUAGU 4969-4989 170 47.62 40.00 95.75 61.12 47
HIV1ID0285 Gene silencing siRNA antisense "si4378" 21 UACAGUCUACUUGUCCAUGCA 4378-4398 pol UGCAUGGACAAGUAGACUGUA 4967-4987 170 42.86 20.00 94.73 52.53 47
HIV1ID0286 Gene silencing siRNA sense "si4373" 21 CCAUGCAUGGACAAGUAGACU 4375-4395 pol CCAUGCAUGGACAAGUAGACU 4964-4984 170 42.86 40.00 94.30 59.05 47
HIV1ID0287 Gene silencing siRNA antisense "si4373" 21 UCUACUUGUCCAUGCAUGGCU 4373-4393 pol AGCCAUGCAUGGACAAGUAGA 4962-4982 170 42.86 40.00 94.50 59.12 47
HIV1ID0288 Gene silencing siRNA sense "si4175" 21 GAGGAAAUGAACAAGUAGAUA 4177-4197 pol GAGGAAAUGAACAAGUAGAUA 4761-4781 170 42.86 60.00 96.27 66.37 47
HIV1ID0289 Gene silencing siRNA antisense "si4175" 21 UCUACUUGUUCAUUUCCUCCA 4175-4195 pol UGGAGGAAAUGAACAAGUAGA 4759-4779 170 42.86 40.00 96.69 59.85 47
HIV1ID0290 Gene silencing siRNA sense "si3011" 21 GAUCACCAGCAAUAUUCCAAA 3013-3033 pol GAUCACCAGCAAUAUUCCAAA 3592-3612 170 33.33 40.00 89.75 54.36 47
HIV1ID0291 Gene silencing siRNA antisense "si3011" 21 UGGAAUAUUGCUGGUGAUCCU 3011-3031 pol AGGAUCACCAGCAAUAUUCCA 3590-3610 170 38.10 40.00 94.27 57.45 47
HIV1ID0292 Gene silencing siRNA sense "si3006" 21 GAAAGGAUCACCAGCAAUAUU 3008-3028 pol GAAAGGAUCACCAGCAAUAUU 3587-3607 170 42.86 20.00 96.06 52.97 47
HIV1ID0293 Gene silencing siRNA antisense "si3006" 21 UAUUGCUGGUGAUCCUUUCCA 3006-3026 pol UGGAAAGGAUCACCAGCAAUA 3585-3605 170 47.62 40.00 96.12 61.25 47
HIV1ID0294 Gene silencing siRNA sense "si3005" 21 GGAAAGGAUCACCAGCAAUAU 3007-3027 pol GGAAAGGAUCACCAGCAAUAU 3586-3606 170 47.62 20.00 96.12 54.58 47
HIV1ID0295 Gene silencing siRNA antisense "si3005" 21 AUUGCUGGUGAUCCUUUCCAU 3005-3025 pol AUGGAAAGGAUCACCAGCAAU 3584-3604 170 47.62 40.00 95.59 61.07 47
HIV1ID0296 Gene silencing siRNA sense "si3000" 21 GGGAUGGAAAGGAUCACCAGC 3002-3022 pol GGGAUGGAAAGGAUCACCAGC 3581-3601 170 52.38 40.00 94.70 62.36 47
HIV1ID0297 Gene silencing siRNA antisense "si3000" 21 UGGUGAUCCUUUCCAUCCCUG 3000-3020 pol CAGGGAUGGAAAGGAUCACCA 3579-3599 170 47.62 40.00 95.17 60.93 47
HIV1ID0298 Gene silencing siRNA sense "si2486" 21 CUACACCUGUCAACAUAAUUG 2488-2508 pol CUACACCUGUCAACAUAAUUG 3064-3077 170 50.00 40.00 93.45 61.15 47
HIV1ID0299 Gene silencing siRNA antisense "si2486" 21 AUUAUGUUGACAGGUGUAGGU 2486-2506 pol ACCUACACCUGUCAACAUAAU 3062-3077 170 50.00 40.00 93.64 61.21 47
HIV1ID0300 Gene silencing siRNA sense "si2485" 21 CCUACACCUGUCAACAUAAUU 2487-2507 pol CCUACACCUGUCAACAUAAUU 3063-3077 170 53.33 40.00 93.89 62.41 47
HIV1ID0301 Gene silencing siRNA antisense "si2485" 21 UUAUGUUGACAGGUGUAGGUC 2485-2505 pol GACCUACACCUGUCAACAUAA 3061-3077 170 52.94 40.00 94.02 62.32 47
HIV1ID0302 Gene silencing siRNA sense "si2333" 21 CAGAUGAUACAGUAUUAGAAG 2335-2355 gag CAGAUGAUACAGUAUUAGAAG 2908-2928 170 38.10 20.00 97.69 51.93 47
HIV1ID0303 Gene silencing siRNA antisense "si2333" 21 UCUAAUACUGUAUCAUCUGCU 2333-2353 gag AGCAGAUGAUACAGUAUUAGA 2906-2926 170 42.86 20.00 97.60 53.49 47
HIV1ID0304 Gene silencing siRNA sense "si2330" 21 GAGCAGAUGAUACAGUAUUAG 2332-2352 gag GAGCAGAUGAUACAGUAUUAG 2905-2925 170 42.86 0.00 97.60 46.82 47
HIV1ID0305 Gene silencing siRNA antisense "si2330" 21 AAUACUGUAUCAUCUGCUCCU 2330-2350 gag AGGAGCAGAUGAUACAGUAUU 2903-2923 170 47.62 20.00 97.66 55.09 47
HIV1ID0306 Gene silencing siRNA sense "si2329" 21 GGAGCAGAUGAUACAGUAUUA 2331-2351 gag GGAGCAGAUGAUACAGUAUUA 2904-2924 170 47.62 0.00 97.66 48.43 47
HIV1ID0307 Gene silencing siRNA antisense "si2329" 21 AUACUGUAUCAUCUGCUCCUG 2329-2349 gag CAGGAGCAGAUGAUACAGUAU 2902-2922 170 52.38 40.00 97.71 63.36 47
HIV1ID0308 Gene silencing siRNA sense "si2075" 21 CAGGCUAAUUUUUUAGGGAAG 2077-2097 gag CAGGCUAAUUUUUUAGGGAAG 2506-2526 170 19.05 20.00 96.56 45.20 47
HIV1ID0309 Gene silencing siRNA antisense "si2075" 21 UCCCUAAAAAAUUAGCCUGUC 2075-2095 gag GACAGGCUAAUUUUUUAGGGA 2504-2524 170 19.05 40.00 97.53 52.19 47
HIV1ID0310 Gene silencing siRNA sense "si1817" 21 GAAGAAAUGAUGACAGCAUGU 1819-1839 gag GAAGAAAUGAUGACAGCAUGU 2206-2226 170 42.86 20.00 96.77 53.21 47
HIV1ID0311 Gene silencing siRNA antisense "si1817" 21 AUGCUGUCAUCAUUUCUUCUA 1817-1837 gag UAGAAGAAAUGAUGACAGCAU 2204-2224 170 38.10 0.00 98.07 45.39 47
HIV1ID0312 Gene silencing siRNA sense "si1490" 21 GACAUAGCAGGAACUACUAGU 1492-1512 gag GACAUAGCAGGAACUACUAGU 1867-1887 170 38.10 40.00 93.73 57.28 47
HIV1ID0313 Gene silencing siRNA antisense "si1490" 21 UAGUAGUUCCUGCUAUGUCAC 1490-1510 gag GUGACAUAGCAGGAACUACUA 1865-1885 170 38.10 40.00 93.73 57.28 47
HIV1ID0314 Gene silencing siRNA sense "si770" 21 GAGGCUAGAAGGAGAGAGAUG 772-792 gag GAGGCUAGAAGGAGAGAGAUG 1080-1090 117 0.00 0.00 97.43 32.48 47
HIV1ID0315 Gene silencing siRNA antisense "si770" 21 UCUCUCUCCUUCUAGCCUCCG 770-790 gag CGGAGGCUAGAAGGAGAGAGA 1041-1051 102 36.36 60.00 98.12 64.83 47
HIV1ID0316 Gene silencing siRNA sense "si764" 21 CUAGCGGAGGCUAGAAGGAGA 766-786 gag CUAGCGGAGGCUAGAAGGAGA 1041-1051 102 36.36 60.00 98.12 64.83 47
HIV1ID0317 Gene silencing siRNA antisense "si764" 21 UCCUUCUAGCCUCCGCUAGUC 764-784 gag GACUAGCGGAGGCUAGAAGGA 1041-1051 102 36.36 60.00 98.12 64.83 47
HIV1ID0318 Gene silencing siRNA sense "si690" 21 CAGGACUCGGCUUGCUGAAGC 692-712 LTR CAGGACUCGGCUUGCUGAAGC 1433-1440 168 0.00 0.00 79.41 26.47 47
HIV1ID0319 Gene silencing siRNA antisense "si690" 21 UUCAGCAAGCCGAGUCCUGCG 690-710 LTR CGCAGGACUCGGCUUGCUGAA 1433-1440 168 0.00 0.00 79.41 26.47 47
HIV1ID0320 Gene silencing siRNA sense "si689" 21 GCAGGACUCGGCUUGCUGAAG 691-711 LTR GCAGGACUCGGCUUGCUGAAG 1433-1440 168 0.00 0.00 79.41 26.47 47
HIV1ID0321 Gene silencing siRNA antisense "si689" 21 UCAGCAAGCCGAGUCCUGCGU 689-709 LTR ACGCAGGACUCGGCUUGCUGA 1433-1440 168 0.00 0.00 79.41 26.47 47
HIV1ID0322 Gene silencing siRNA sense "si575" 21 GACUCUGGUAACUAGAGAUCC 577-597 5'LTR GACUCUGGUAACUAGAGAUCC 725-744 61 50.00 80.00 97.20 75.73 47
HIV1ID0323 Gene silencing siRNA antisense "si575" 21 AUCUCUAGUUACCAGAGUCAC 575-595 5'LTR GUGACUCUGGUAACUAGAGAU 725-742 61 44.44 40.00 96.88 60.44 47
HIV1ID0324 Gene silencing siRNA sense "si554" 21 GUGUGUGCCCGUCUGUUGUGU 576-596 5'LTR UGACUCUGGUAACUAGAGAUC 725-743 61 47.37 60.00 97.05 68.14 47
HIV1ID0325 Gene silencing siRNA antisense "si554" 21 ACAACAGACGGGCACACACUA 554-574 5'LTR UAGUGUGUGCCCGUCUGUUGU 685-706 61 0.00 0.00 93.97 31.32 47
HIV1ID0326 Gene silencing siRNA sense "si521" 21 CCUCAAUAAAGCUUGCCUUGA 523-543 5'LTR CCUCAAUAAAGCUUGCCUUGA 648-669 49 0.00 0.00 94.27 31.42 47
HIV1ID0327 Gene silencing siRNA antisense "si521" 21 AAGGCAAGCUUUAUUGAGGCU 521-541 5'LTR AGCCUCAAUAAAGCUUGCCUU 648-667 48 0.00 0.00 94.86 31.62 47
HIV1ID0328 Gene silencing siRNA sense "si515" 21 CUUAAGCCUCAAUAAAGCUUG 517-537 5'LTR CUUAAGCCUCAAUAAAGCUUG 638-656 45 15.79 40.00 94.40 50.06 47
HIV1ID0329 Gene silencing siRNA antisense "si515" 21 AGCUUUAUUGAGGCUUAAGCA 515-535 5'LTR UGCUUAAGCCUCAAUAAAGCU 636-656 45 14.29 40.00 94.72 49.67 47
HIV1ID0330 Gene silencing siRNA sense "si512" 21 CUGCUUAAGCCUCAAUAAAGC 514-534 5'LTR CUGCUUAAGCCUCAAUAAAGC 635-656 45 13.64 40.00 94.94 49.53 47
HIV1ID0331 Gene silencing siRNA antisense "si512" 21 UUUAUUGAGGCUUAAGCAGUG 512-532 5'LTR CACUGCUUAAGCCUCAAUAAA 633-655 45 13.04 40.00 95.32 49.46 47
HIV1ID0332 Gene silencing siRNA sense "si510" 21 CACUGCUUAAGCCUCAAUAAA 512-532 5'LTR CACUGCUUAAGCCUCAAUAAA 633-655 45 13.04 40.00 95.32 49.46 47
HIV1ID0333 Gene silencing siRNA antisense "si510" 21 UAUUGAGGCUUAAGCAGUGGG 510-530 5'LTR CCCACUGCUUAAGCCUCAAUA 631-653 45 8.70 40.00 95.46 48.05 47
HIV1ID0334 Gene silencing siRNA sense "si509" 21 CCACUGCUUAAGCCUCAAUAA 511-531 5'LTR CCACUGCUUAAGCCUCAAUAA 632-654 45 13.04 40.00 95.51 49.52 47
HIV1ID0335 Gene silencing siRNA antisense "si509" 21 AUUGAGGCUUAAGCAGUGGGU 509-529 5'LTR ACCCACUGCUUAAGCCUCAAU 630-645 43 0.00 0.00 95.66 31.89 47
HIV1ID0336 Gene silencing siRNA sense sequence "TAR" 21 AGACCAGATCTGAGCCTGGTT 468-488 5'LTR AGACCAGAUCUGAGCCUGGGA 586-605 39 10.00 40.00 92.29 47.43 48
HIV1ID0337 Gene silencing siRNA sense sequence "Tat(SF2)" 21 CTGCTTGTAACAATTGCTATT 5889-5909 tat CUGCUUGUACCAAUUGCUAUU 6524-6544 170 14.29 0.00 80.25 31.51 48
HIV1ID0338 Gene silencing shRNA sequence "vif" 49 GTTCAGAAGTACACATCCCTTCAAGAGAGG(...) 5193-5213 sor AAGUUCAGAAGUACACAUCCC 5784-5804 170 28.57 60.00 95.40 61.32 49
HIV1ID0339 Gene silencing shRNA sequence "gag" 49 GATTGTACTGAGAGACAGGTTCAAGAGACC(...) 2060-2080 gag AAGAUUGUACUGAGAGACAGG 2499-2509 170 9.09 20.00 91.68 40.26 49
HIV1ID0340 Gene silencing shRNA sequence "rev" 49 GGCACTTATCTGGGACGATTTCAAGAGAAT(...) 8483-8501 env GGCACUUAUCUGGGACGAU 9603-9621 170 21.05 40.00 79.77 46.94 49
HIV1ID0341 Gene silencing shRNA sequence "Nef" 49 GTGCCTGGCTAGAAGCACATTCAAGAGATG(...) 8960-8978 27k protein GUGCCUGGCUAGAAGCACA 10198-10216 164 5.26 20.00 85.72 36.99 50
HIV1ID0342 Gene silencing shRNA sequence "UTR-B" 49 GGCTAGAAGGAGAGAGATGTTCAAGAGACA(...) 774-792 LTR GGCUAGAAGGAGAGAGAUG 1080-1090 117 0.00 0.00 97.43 32.48 50
HIV1ID0343 Gene silencing shRNA sequence "UTR-A" 49 GCGGAGGCTAGAAGGAGAGTTCAAGAGACT(...) 769-787 LTR GCGGAGGCUAGAAGGAGAG 1041-1051 102 36.36 60.00 98.12 64.83 50
HIV1ID0344 Gene silencing shRNA sequence "TatRev-B" 49 CCTATGGCAGGAAGAAGCGTTCAAGAGACG(...) 5967-6016 tat CCUAUGGCAGGAAGAAGCGGAGACAGCGAC(...) 6617-6674 170 18.97 0.00 84.26 34.41 50
HIV1ID0345 Gene silencing shRNA sequence "TatRev-A" 49 GCCTTAGGCATCTCCTATGTTCAAGAGACA(...) 5954-5972 tat GCCUUAGGCAUCUCCUAUG 6604-6622 170 26.32 40.00 94.49 53.60 50
HIV1ID0346 Gene silencing shRNA sequence "PPT" 49 GGGGGGACTGGAAGGGCTATTCAAGAGATA(...) 9078-9096 27k protein GGGGGGACUGGAAGGGCUA 10325-10343 163 21.05 0.00 93.05 38.03 50
HIV1ID0347 Gene silencing shRNA sequence "PBS-B" 51 TGGCGCCCGAACAGGGACTTTTCAAGAGAA(...) 636-653 LTR UGGCGCCCGAACAGGGAC 791-808 80 5.56 20.00 97.15 40.90 50
HIV1ID0348 Gene silencing shRNA sequence "shRNA-1" 53 GTGGCGCCCGAACAGGGACTTTTCAAGAGA(...) 635-653 LTR GUGGCGCCCGAACAGGGAC 790-808 80 5.26 20.00 96.88 40.71 50
HIV1ID0349 Gene silencing siRNA sense sequence "M441" 21 CTTGGCACTAACAGCATTATT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 6081-6101 170 9.52 0.00 81.23 30.25 51
HIV1ID0350 Gene silencing siRNA antisense sequence "M441" 21 TAATGCTGTTAGTGCCAAGTT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 6081-6101 170 9.52 0.00 81.23 30.25 51
HIV1ID0351 Gene silencing siRNA sense sequence "M98" 20 GAAAGCTAGGGGATGGTTTT 5139-5158 sor GAAAGCUAGGGGAUGGUUUU 5730-5749 170 5.00 0.00 76.86 27.29 51
HIV1ID0352 Gene silencing siRNA antisense sequence "M98" 20 AACCATCCCCTAGCTTTCTT 5139-5158 sor GAAAGCUAGGGGAUGGUUUU 5730-5749 170 5.00 0.00 76.86 27.29 51
HIV1ID0353 Gene silencing siRNA sense sequence "MTAR" 21 AGACCAGATATGAGCCTGGTT 9553-9573 3'LTR AGACCAGAUCUGAGCCUGGGA 10965-10985 109 0.00 0.00 90.45 30.15 51
HIV1ID0354 Gene silencing siRNA antisense sequence "MTAR" 21 CCAGGCTCATATCTGGTCTTT 9551-9571 3'LTR UUAGACCAGAUCUGAGCCUGG 10965-10983 109 0.00 20.00 89.95 36.65 51
HIV1ID0355 Gene silencing siRNA sense sequence "TAR" 21 AGACCAGATCTGAGCCTGGTT 9553-9573 3'LTR AGACCAGAUCUGAGCCUGGGA 10965-10985 109 0.00 0.00 90.45 30.15 51
HIV1ID0356 Gene silencing siRNA antisense sequence "TAR" 21 CCAGGCTCAGATCTGGTCTTT 9551-9571 3'LTR UUAGACCAGAUCUGAGCCUGG 10965-10983 109 0.00 20.00 89.95 36.65 51
HIV1ID0357 Gene silencing siRNA sense sequence "nef" 21 GTGCCTGGCTAGAAGCACATT 8960-8980 27k protein GUGCCUGGCUAGAAGCACAAG 10198-10218 164 4.76 20.00 85.55 36.77 51
HIV1ID0358 Gene silencing siRNA antisense sequence "nef" 21 TGTGCTTCTAGCCAGGCACTT 8968-8988 27k protein CUAGAAGCACAAGAGGAGGAG 10206-10226 164 4.76 0.00 81.62 28.79 51
HIV1ID0359 Gene silencing siRNA sense sequence "M388" 21 GACTTCAAGGGAGATGGCATT 2916-2936 pol GACUUCAGGAAGUAUACUGCA 3495-3515 170 28.57 60.00 84.30 57.63 51
HIV1ID0360 Gene silencing siRNA antisense sequence "M388" 21 TGCCATCTCCCTTGAAGTCTT 5050-5070 pol AGAUGGCAGGUGAUGAUUGUG 5641-5661 170 38.10 20.00 96.97 51.69 51
HIV1ID0361 Gene silencing siRNA sense sequence "G388" 21 GACTTCAAGGAAGATGGCATT 2916-2936 pol GACUUCAGGAAGUAUACUGCA 3495-3515 170 28.57 60.00 84.30 57.63 51
HIV1ID0362 Gene silencing siRNA antisense sequence "G388" 21 TGCCATCTTCCTTGAAGTCTT 5050-5070 pol AGAUGGCAGGUGAUGAUUGUG 5641-5661 170 38.10 20.00 96.97 51.69 51
HIV1ID0363 Gene silencing siRNA sense sequence "T441" 21 CTTGGCACTAGCAGCATTATT 5481-5501 sor CUUGGCACUAGCAGCAUUAAU 6081-6101 170 9.52 0.00 81.23 30.25 51
HIV1ID0364 Gene silencing siRNA antisense sequence "T441" 21 TAATGCTGCTAGTGCCAAGTT 5479-5499 sor UACUUGGCACUAGCAGCAUUA 6079-6099 170 14.29 0.00 84.75 33.01 51
HIV1ID0365 Gene silencing siRNA sense sequence "T283" 21 AGCACACAAGTAGACCCTGTT 5323-5343 sor AGCACACAAGUAGACCCUGAA 5920-5940 170 23.81 20.00 86.55 43.45 51
HIV1ID0366 Gene silencing siRNA antisense sequence "T283" 21 CAGGGTCTACTTGTGTGCTTT 5321-5341 sor AUAGCACACAAGUAGACCCUG 5918-5938 170 28.57 40.00 89.12 52.56 51
HIV1ID0367 Gene silencing siRNA sense sequence "T98" 21 GGAAAGCTAAGGACTGGTTTT 5138-5158 sor GGAAAGCUAGGGGAUGGUUUU 5729-5749 170 4.76 0.00 76.17 26.98 51
HIV1ID0368 Gene silencing siRNA antisense sequence "T98" 21 AACCAGTCCTTAGCTTTCCTT 3470-3490 pol AGAGAUUCUAAAAGAACCAGU 4050-4070 170 9.52 20.00 87.51 39.01 51
HIV1ID0369 Gene silencing siRNA sense sequence "RT2" 21 TGAGACACCAGGGATTAGATT 2960-2980 pol UGAGACACCAGGGAUUAGAUA 3539-3559 170 33.33 40.00 91.84 55.06 52
HIV1ID0370 Gene silencing siRNA antisense sequence "RT2" 21 TCTAATCCCTGGTGTCTCATT 2958-2978 pol AAUGAGACACCAGGGAUUAGA 3537-3557 170 38.10 20.00 91.89 50.00 52
HIV1ID0371 Gene silencing siRNA sense sequence "RT1" 21 GAGACACCAGGGATTAGATTT 2961-2981 pol GAGACACCAGGGAUUAGAUAU 3540-3560 170 33.33 20.00 91.18 48.17 52
HIV1ID0372 Gene silencing siRNA antisense sequence "RT1" 21 ATCTAATCCCTGGTGTCTCTT 2959-2979 pol AUGAGACACCAGGGAUUAGAU 3538-3558 170 33.33 20.00 91.84 48.39 52
HIV1ID0373 Gene silencing siRNA sense sequence "tat3" 21 GAAGCGGAGACAGCGACGATT 5980-6000 tat GAAGCGGAGACAGCGACGAAG 6630-6642 170 30.77 0.00 86.82 39.20 52
HIV1ID0374 Gene silencing siRNA antisense sequence "tat3" 21 TCGTCGCTGTCTCCGCTTCTT 5978-5998 tat AAGAAGCGGAGACAGCGACGA 6628-6642 170 33.33 0.00 88.50 40.61 52
HIV1ID0375 Gene silencing siRNA sense sequence "tat2" 21 CTAGAGCCCTGGAAGCATCTT 5852-5872 tat CUAGAGCCCUGGAAGCAUCCA 6487-6507 170 38.10 60.00 88.84 62.31 52
HIV1ID0376 Gene silencing siRNA antisense sequence "tat2" 21 GATGCTTCCAGGGCTCTAGTT 5850-5870 tat GACUAGAGCCCUGGAAGCAUC 6485-6505 170 33.33 60.00 86.06 59.80 52
HIV1ID0377 Gene silencing siRNA sense sequence "tat1" 21 TATGGCAGGAAGAAGCGGATT 5969-5989 tat UAUGGCAGGAAGAAGCGGAGA 6619-6639 170 52.38 20.00 95.09 55.82 52
HIV1ID0378 Gene silencing siRNA antisense sequence "tat1" 21 TCCGCTTCTTCCTGCCATATT 5967-5987 tat CCUAUGGCAGGAAGAAGCGGA 6617-6637 170 52.38 20.00 96.72 56.37 52
HIV1ID0379 Gene silencing shRNA sequence "Tat" 49 TATGGCAGGAAGAAGCGGATTCAAGAGATC(...) 5969-5987 tat UAUGGCAGGAAGAAGCGGA 6619-6637 170 57.89 20.00 97.61 58.50 53
HIV1ID0380 Gene expression siRNA sense sequence "p24" 21 GATTGTACTGAGAGACAGGCT 2062-2082 gag GAUUGUACUGAGAGACAGGCU 2499-2511 170 7.69 20.00 91.92 39.87 54