Database reference: HIV2ID0062

Virus: HIV-2

Type of target: PCR primer

Techniques: Nested PCR

Target: Primer reverse

Status: Published

Original name: DR TAT1

Target length: 20

Amplicon length:

Sequence (5'-3'): TTGAGTGCCGACATCCCCCT

Position in reference genome: 5915-5934

Genomic region: tat

Related image:

Related publications:
Damond, Florence, et al. Identification of a highly divergent HIV type 2 and proposal for a change in HIV type 2 classification.�AIDS research and human retroviruses�20.6 (2004): 666-672.