Database reference: HIV2ID0032

Virus: HIV-2

Type of target: PCR primer pair

Techniques: Taqman real-time PCR

Target: Primer forward

Status: Published

Original name: HIV-2TM1sfpr

Target length: 21

Amplicon length: 355

Sequence (5'-3'): CGCCTGGTCATTCGGTGTTCA

Position in reference genome: 207-227

Genomic region: LTR

Related image:

Related publications:
Schutten, Martin, et al. "Development of a real-time quantitative RT-PCR for the detection of HIV-2 RNA in plasma."�Journal of virological methods�88.1 (2000): 81-87.