Database reference: HIV2ID0030

Virus: HIV-2

Type of target: Probe

Techniques: Taqman real-time PCR

Target: Probe

Status: Published

Original name: Tmprobe 2.1

Target length: 27

Amplicon length:

Sequence (5'-3'): TCGCCCACACAATTAAGCATTTGGTTG

Position in reference genome: 1103-1129

Genomic region: gag

Related image:

Related publications:
Schutten, Martin, et al. "Development of a real-time quantitative RT-PCR for the detection of HIV-2 RNA in plasma."�Journal of virological methods�88.1 (2000): 81-87.