Database reference: HIV2ID0025

Virus: HIV-2

Type of target: PCR primer pair

Techniques: Taqman real-time PCR

Target: Primer forward

Status: Published

Original name: HIV-2TMfpr1

Target length: 20

Amplicon length: 81

Sequence (5'-3'): AACAAACCACGACGGAGTGC

Position in reference genome: 379-398

Genomic region: ?

Related image:

Related publications:
Schutten, Martin, et al. "Development of a real-time quantitative RT-PCR for the detection of HIV-2 RNA in plasma."�Journal of virological methods�88.1 (2000): 81-87.