Database reference: HIV2ID0024

Virus: HIV-2

Type of target: PCR primer

Techniques: Reverse transcriptase PCR

Target: Primer reverse

Status: Published/ patent

Original name: Seq.ID.NO.17

Target length: 27

Amplicon length:

Sequence (5'-3'): TTCCACAGCTGATCTCTGCCTTCTCTG

Position in reference genome: 4738-4764

Genomic region: pol

Related image:

Related publications:
Abravaya, Klara, et al. "Performance of a multiplex qualitative PCR LCx assay for detection of human immunodeficiency virus type 1 (HIV-1) group M subtypes, group O, and HIV-2."�Journal of clinical microbiology�38.2 (2000): 716-723.