Database reference: HIV2ID0015

Virus: HIV-2

Type of target: PCR primer

Techniques: Reverse Transcription�Loop-Mediated Isothermal Amplification

Target: Primer reverse

Status: Published

Original name: A-Loop B

Target length: 21

Amplicon length:

Sequence (5'-3'): AATTTTAAAAGAAGGGGAGGA

Position in reference genome: 4607-4627

Genomic region: pol

Related image:

Related publications:
Curtis, Kelly A., et al. "Real-Time Detection of HIV-2 by Reverse Transcription�Loop-Mediated Isothermal Amplification."�Journal of clinical microbiology�52.7 (2014): 2674-2676.