Database reference: HIV2ID0013

Virus: HIV-2

Type of target: PCR primer

Techniques: Reverse Transcription�Loop-Mediated Isothermal Amplification

Target: Primer reverse

Status: Published

Original name: A-B3

Target length: 23

Amplicon length:

Sequence (5'-3'): ATTGTATTTCTTGTTCTGTGGTG

Position in reference genome: 4657-4679

Genomic region: pol

Related image:

Related publications:
Curtis, Kelly A., et al. "Real-Time Detection of HIV-2 by Reverse Transcription�Loop-Mediated Isothermal Amplification."�Journal of clinical microbiology�52.7 (2014): 2674-2676.