Database reference: HIV2ID0004
Virus: HIV-2
Type of target: PCR primer pair
Techniques: Multiplex real-time PCR & molecular beacons
Target: PCR primer reverse
Status: Published
Original name: SR65, envR
Target length: 23
Amplicon length:
Sequence (5'-3'): CCCATGGTACAGTAGTGTGGCAG
Position in reference genome:
Genomic region: env
Related image:
Related publications:
Vet, Jacqueline AM, et al. "Multiplex detection of four pathogenic retroviruses using molecular beacons." Proceedings of the National Academy of Sciences 96.11 (1999): 6394-6399. // Sanders-Buell, Eric, Mika O. Salminen, and Francine E. McCutchan. "Sequencing primers for HIV-1." Human retroviruses and AIDS (1995): 15-21.
Heredia, Alonso, et al. "Enhanced diagnostic efficiency of the polymerase chain reaction by co-amplification of multiple regions of HIV-1 and HIV-2." Journal of virological methods 49.1 (1994): 37-46.