Database reference: HIV2ID0003

Virus: HIV-2

Type of target: PCR primer pair

Techniques: Multiplex real-time PCR & molecular beacons

Target: PCR primer forward

Status: Published

Original name: SR64, envF

Target length: 23

Amplicon length: 106

Sequence (5'-3'): CTCCAGGCAAGAGTCACTGCTAT

Position in reference genome: 7869-7891

Genomic region: env

Related image:



Related publications:
Vet, Jacqueline AM, et al. "Multiplex detection of four pathogenic retroviruses using molecular beacons." Proceedings of the National Academy of Sciences 96.11 (1999): 6394-6399. // Sanders-Buell, Eric, Mika O. Salminen, and Francine E. McCutchan. "Sequencing primers for HIV-1." Human retroviruses and AIDS (1995): 15-21.


Heredia, Alonso, et al. "Enhanced diagnostic efficiency of the polymerase chain reaction by co-amplification of multiple regions of HIV-1 and HIV-2." Journal of virological methods 49.1 (1994): 37-46.