Database reference: HIV2ID0001

Virus: HIV-2

Type of target: PCR primer pair

Techniques: PCR

Target: PCR primer forward

Status: Published

Original name: SR74

Target length: 21

Amplicon length: 392

Sequence (5'-3'): GGGAGATGGGCGCGAGAAACT

Position in reference genome: 541-561

Genomic region: gag

Related image:

Related publications:
De Crignis, Elisa, et al. "HIV-1 and HCV detection in dried blood spots by SYBR Green multiplex real-time RT-PCR." Journal of virological methods 165.1 (2010): 51-56.