Database reference: HIV1ID0338

Virus: HIV-1

Type of target: shRNA

Techniques: Gene silencing

Target: shRNA sequence

Status:

Original name: "vif"

Target length: 49

Amplicon length:

Sequence (5'-3'): GTTCAGAAGTACACATCCCTTCAAGAGAGGGATGTGTACTTCTGAACTT

Position in reference genome: 5193-5213

Genomic region: sor

Related image:

Related publications:
Lentiviral delivery of short hairpin RNAs protects CD4 T cells from multiple clades and primary isolates of HIV. Lee SK, Dykxhoorn DM, Kumar P, Ranjbar S, Song E, Maliszewski LE, Fran�ois-Bongar�on V, Goldfeld A, Swamy NM, Lieberman J, Shankar P.