Database reference: HIV1ID0337
Virus: HIV-1
Type of target: siRNA
Techniques: Gene silencing
Target: siRNA sense sequence
Status: Original name: "Tat(SF2)"
Target length: 21
Amplicon length: Sequence (5'-3'): CTGCTTGTAACAATTGCTATT
Position in reference genome: 5889-5909 | Genomic region: tat
Related image: Related publications: Small interfering RNAs against the TAR RNA binding protein, TRBP, a Dicer cofactor, inhibit human immunodeficiency virus type 1 long terminal repeat expression and viral production.
Christensen HS, Daher A, Soye KJ, Frankel LB, Alexander MR, Lain� S, Bannwarth S, Ong CL, Chung SW, Campbell SM, Purcell DF, Gatignol A.