Database reference: HIV1ID0337

Virus: HIV-1

Type of target: siRNA

Techniques: Gene silencing

Target: siRNA sense sequence

Status:

Original name: "Tat(SF2)"

Target length: 21

Amplicon length:

Sequence (5'-3'): CTGCTTGTAACAATTGCTATT

Position in reference genome: 5889-5909

Genomic region: tat

Related image:

Related publications:
Small interfering RNAs against the TAR RNA binding protein, TRBP, a Dicer cofactor, inhibit human immunodeficiency virus type 1 long terminal repeat expression and viral production. Christensen HS, Daher A, Soye KJ, Frankel LB, Alexander MR, Lain� S, Bannwarth S, Ong CL, Chung SW, Campbell SM, Purcell DF, Gatignol A.