Database reference: HIV1ID0253

Virus: HIV-1

Type of target: Primer pair

Techniques: PCR

Target: PCR primer reverse

Status: Published

Original name: "LEX074"

Target length: 20

Amplicon length:

Sequence (5'-3'): GACAATGCAGAACTGGGTAA

Position in reference genome: 7059-7078

Genomic region: env

Related image:

Related publications:
A 4,103 marker integrated physical and comparative map of the horse genome. Raudsepp T, Gustafson-Seabury A, Durkin K, Wagner ML, Goh G, Seabury CM, Brinkmeyer-Langford C, Lee EJ, Agarwala R, Stallknecht-Rice E, Sch�ffer AA, Skow LC, Tozaki T, Yasue H, Penedo MC, Lyons LA, Khazanehdari KA, Binns MM, MacLeod JN, Distl O, Gu�rin G, Leeb T, Mickelson JR, Chowdhary BP.