Database reference: HIV1ID0253
Virus: HIV-1
Type of target: Primer pair
Techniques: PCR
Target: PCR primer reverse
Status: Published
Original name: "LEX074"
Target length: 20
Amplicon length: Sequence (5'-3'): GACAATGCAGAACTGGGTAA
Position in reference genome: 7059-7078 | Genomic region: env
Related image: Related publications: A 4,103 marker integrated physical and comparative map of the horse genome.
Raudsepp T, Gustafson-Seabury A, Durkin K, Wagner ML, Goh G, Seabury CM, Brinkmeyer-Langford C, Lee EJ, Agarwala R, Stallknecht-Rice E, Sch�ffer AA, Skow LC, Tozaki T, Yasue H, Penedo MC, Lyons LA, Khazanehdari KA, Binns MM, MacLeod JN, Distl O, Gu�rin G, Leeb T, Mickelson JR, Chowdhary BP.