Database reference: HIV1ID0220

Virus: HIV-1

Type of target: Primer pair

Techniques: PCR

Target: PCR primer forward

Status: Published

Original name: "5'HIV-TR-16"

Target length: 26

Amplicon length:

Sequence (5'-3'): CCTCTATTGTGTGCATCAAAGGATAG

Position in reference genome: 1041-1066

Genomic region: gag

Related image:

Related publications:
Yeast genetic analysis reveals the involvement of chromatin reassembly factors in repressing HIV-1 basal transcription. Vanti M, Gallastegui E, Respaldiza I, Rodr�guez-Gil A, G�mez-Herreros F, Jimeno-Gonz�lez S, Jordan A, Ch�vez S.