Database reference: HIV1ID0213

Virus: HIV-1

Type of target: Primer

Techniques: Site-directed mutagenesis

Target: PCR primer

Status: Published

Original name: "V18BS 431 AF"

Target length: 30

Amplicon length:

Sequence (5'-3'): TGTACTGAGAGACAGGCTAATTTTTTAGGG

Position in reference genome: 2065-2094

Genomic region: gag

Related image:

Related publications:
Gag mutations strongly contribute to HIV-1 resistance to protease inhibitors in highly drug-experienced patients besides compensating for fitness loss. Dam E, Quercia R, Glass B, Descamps D, Launay O, Duval X, Kr�usslich HG, Hance AJ, Clavel F; ANRS 109 Study Group.