Database reference: HIV1ID0209
Virus: HIV-1
Type of target: Primer pair
Techniques: PCR
Target: PCR primer reverse
Status: Published
Original name: "Proviral HIV-1"
Target length: 22
Amplicon length: Sequence (5'-3'): CTGCTAGAGATTTTCCACACTG
Position in reference genome: 614-635 | Genomic region: LTR
Related image: Related publications: Factors associated with HIV-1 proviral DNA loads in patients with undetectable plasma RNA load.
Choi JY, Song YG, Kim YH, Kim CO, Kim MS, Chin BS, Han SH, Choi SH, Lee HS, Jeong SJ, Choi H, Kim JM.