Database reference: HIV1ID0208

Virus: HIV-1

Type of target: Primer pair

Techniques: PCR

Target: PCR primer forward

Status: Published

Original name: "Proviral HIV-1"

Target length: 22

Amplicon length:

Sequence (5'-3'): GGTCTCTCTGGTTAGACCAGAT

Position in reference genome: 455-476

Genomic region: LTR

Related image:

Related publications:
Factors associated with HIV-1 proviral DNA loads in patients with undetectable plasma RNA load. Choi JY, Song YG, Kim YH, Kim CO, Kim MS, Chin BS, Han SH, Choi SH, Lee HS, Jeong SJ, Choi H, Kim JM.