Database reference: HIV1ID0204

Virus: HIV-1

Type of target: Probe

Techniques: Alu-PCR

Target: Probe

Status: Published

Original name: MH603

Target length: 30

Amplicon length:

Sequence (5'-3'): ACACTACTTGAAGCACTCAAGGCAAGCTTT

Position in reference genome: 530-559

Genomic region: LTR

Related image:

Related publications:
Butler, Scott L., Mark ST Hansen, and Frederic D. Bushman. "A quantitative assay for HIV DNA integration in vivo."�Nature medicine�7.5 (2001): 631-634.