Database reference: HIV1ID0193

Virus: HIV-1

Type of target: Primer pair

Techniques: RT-LAMP

Target: Primer forward

Status: Published

Original name: p24LoopF

Target length: 25

Amplicon length: 124

Sequence (5'-3'): TTTAACATTTGCATGGCTGCTTGAT

Position in reference genome: 1370-1394

Genomic region: gag

Related image:

Related publications:
Curtis, Kelly A., Donna L. Rudolph, and S. Michele Owen. "Rapid detection of HIV-1 by reverse-transcription, loop-mediated isothermal amplification (RT-LAMP)."�Journal of virological methods�151.2 (2008): 264-270.