Database reference: HIV1ID0174

Virus: HIV-1

Type of target: Probe

Techniques: Real-time PCR

Target: Probe

Status: Published

Original name: Repliprobe

Target length: 24

Amplicon length:

Sequence (5'-3'): TGTCTTACTTTGATAAAACCTCC

Position in reference genome: 2403-2426

Genomic region: pol

Related image:

Related publications:
Balzarini, Jan, et al. "2', 5'-Bis-O-(tert-butyldimethylsilyl)-3'-spiro-5''-(4''-amino-1'', 2''-oxathiole-2'', 2'-dioxide) pyrimidine (TSAO) nucleoside analogues: highlyselective inhibitors of human immunodeficiency virus type 1 that are targeted at the viral reverse transcriptase."�Proceedings of the National Academy of Sciences�89.10 (1992): 4392-4396.