Database reference: HIV1ID0169

Virus: HIV-1

Type of target: Primer

Techniques: Real-time PCR

Target: Primer reverse

Status: Published

Original name: B3

Target length: 21

Amplicon length:

Sequence (5'-3'): CCTACATACAAATCATCCATG

Position in reference genome: 3098-3118

Genomic region: pol

Related image:

Related publications:
Curtis, Kelly A., et al. "Isothermal amplification using a chemical heating device for point-of-care detection of HIV-1."�PloS one�7.2 (2012): e31432.