Database reference: HIV1ID0162

Virus: HIV-1

Type of target: Primer pair

Techniques: PCR

Target: Primer reverse

Status: Published

Original name: RU5R

Target length: 26

Amplicon length:

Sequence (5'-3'): GCGCCACTGCTAGAGATTTTCCACAC

Position in reference genome: 616-641

Genomic region: LTR

Related image:

Related publications:
Wang, Jung-Hao, et al. "An integrated chip capable of performing sample pretreatment and nucleic acid amplification for HIV-1 detection."�Biosensors and Bioelectronics�41 (2013): 484-491.