Database reference: HIV1ID0157

Virus: HIV-1

Type of target: Primer pair

Techniques: One-step RT-PCR

Target: Primer forward

Status: Published

Original name: Pan-HIV-1_3F

Target length: 23

Amplicon length: 3066

Sequence (5'-3'): TTAAAAGAAAAGGGGGGATTGGG

Position in reference genome: 4783-4805

Genomic region: pol

Related image:

Related publications:
Gall, Astrid, et al. "Universal amplification, next-generation sequencing, and assembly of HIV-1 genomes."�Journal of clinical microbiology�50.12 (2012): 3838-3844.