Database reference: HIV1ID0152

Virus: HIV-1

Type of target: Primer pair

Techniques: Multiplex real-time PCR & Flow Cytometer - Microsphere-Based Hybridization Assay

Target:

Status: Published

Original name: SK431

Target length: 27

Amplicon length:

Sequence (5'-3'): TGCTATGTCAGTTCCCCTTGGTTCTCT

Position in reference genome: 1491-1517

Genomic region: gag

Related image:

Related publications:
Defoort, J-P., et al. "Simultaneous detection of multiplex-amplified human immunodeficiency virus type 1 RNA, hepatitis C virus RNA, and hepatitis B virus DNA using a flow cytometer microsphere-based hybridization assay." Journal of clinical microbiology 38.3 (2000): 1066-1071.