Database reference: HIV1ID0033

Virus: HIV-1

Type of target: PCR primer pair

Techniques: SYBR Green real time PCR

Target: PCR primer reverse

Status: Published

Original name: NP52

Target length: 24

Amplicon length:

Sequence (5'-3'): GGGTAAATCTGACTTGCCCAATTC

Position in reference genome: 3341-3364

Genomic region: pol

Related image:

Related publications:
Pripuzova, Natalia, et al. "Development of Real-Time PCR Array for Simultaneous Detection of Eight Human Blood-Borne Viral Pathogens." PloS one 7.8 (2012): e43246.