Database reference: HIV1ID0018
Virus: HIV-1
Type of target: PCR primer pair
Techniques: Multiplex real-time PCR & molecular beacons
Target: PCR primer forward
Status: Published
Original name: SK 38, gagF
Target length: 28
Amplicon length: 115
Sequence (5'-3'): ATAATCCACCTATCCCAGTAGGAGAAAT
Position in reference genome: 1544-1571 | Genomic region: gag
Related image: Related publications: Vet, Jacqueline AM, et al. "Multiplex detection of four pathogenic retroviruses using molecular beacons." Proceedings of the National Academy of Sciences 96.11 (1999): 6394-6399. // Sanders-Buell, Eric, Mika O. Salminen, and Francine E. McCutchan. "Sequencing primers for HIV-1." Human retroviruses and AIDS (1995): 15-21.Sanders-Buell, Eric, Mika O. Salminen, and Francine E. McCutchan. "Sequencing primers for HIV-1." Human retroviruses and AIDS (1995): 15-21.Pripuzova, Natalia, et al. "Development of Real-Time PCR Array for Simultaneous Detection of Eight Human Blood-Borne Viral Pathogens." PloS one 7.8 (2012): e43246.Ou, Chin-Yih, et al. "DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells." Science 239.4837 (1988): 295-297.