Database reference: HIV1ID0014
Virus: HIV-1
Type of target: Probe
Techniques: Multiplex real-time PCR & molecular beacons
Target: Probe (molecular beacons)
Status: Published
Original name:
Target length: 32
Amplicon length:
Sequence (5'-3'): CCCGTGGTTTATTACAGGGACAGCAGAACGGG
Position in reference genome:
Genomic region: pol
Related image:
Related publications:
Paryan, Mahdi, et al. "Design and Development of a Multiplex Real-Time PCR Assay for Detection of HIV-1 and HCV Using Molecular Beacons." Indian journal of microbiology 52.3 (2012): 456-463.