Database reference: HIV1ID0009
Virus: HIV-1
Type of target: PCR primer pair
Techniques: Multiplex-RT PCR & ELISA
Target: PCR primer forward
Status: Published
Original name: F2
Target length: 23
Amplicon length: 189
Sequence (5'-3'): CAGAAGGAGCCACCCCACAAGAT
Position in reference genome:
Genomic region: gag
Related image:
Related publications:
Comparison of Multiplex PCR-ELISA and conventional Multiplex PCR for detection of HIV-1/HCV co-infection M Ravanshad - Iranian Journal of Microbiology, 2012