Database reference: HIV1ID0008

Virus: HIV-1

Type of target: Probe

Techniques: PCR

Target: Probe

Status: Published

Original name: CO3

Target length: 40

Amplicon length:

Sequence (5'-3'): TGAGTTGCAACAGATGCTGTTGCGCCTCAATAGCCCTCAG

Position in reference genome: 7890-7929

Genomic region: env

Related image:

Related publications:
Ou, Chin-Yih, et al. "DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells." Science 239.4837 (1988): 295-297.