Database reference: HIV1ID0004

Virus: HIV-1

Type of target: PCR primer pair

Techniques: Nested PCR

Target: PCR primer reverse

Status: Published

Original name: A1353

Target length: 23

Amplicon length:

Sequence (5'-3'): TGTTCGGGCGCCACTGCTAGAGA

Position in reference genome: 626-648

Genomic region: 5'LTR

Related image:



Related publications:
Cleland, A., Davis, C., Adams, N., Lycett, C., Jarvis, L. M., Holmes, H., & Simmonds, P. (2001). Development of multiplexed nucleic acid testing for human immunodeficiency virus type 1 and hepatitis C virus. Vox sanguinis, 81(2), 93-101.