Database reference: HIV1ID0003
Virus: HIV-1
Type of target: PCR primer pair
Techniques: Nested PCR
Target: PCR primer forward
Status: Published
Original name: A1354
Target length: 21
Amplicon length: 125
Sequence (5'-3'): CTCAATAAAGCTTGCCTTGAG
Position in reference genome: 524-544 | Genomic region: 5'LTR
Related image: Related publications: Cleland, A., Davis, C., Adams, N., Lycett, C., Jarvis, L. M., Holmes, H., & Simmonds, P. (2001). Development of multiplexed nucleic acid testing for human immunodeficiency virus type 1 and hepatitis C virus. Vox sanguinis, 81(2), 93-101.